All this by way of agreeing with Davidson, that while it is tempting to think of language as dependent on agreed conventions of some sort, it isn't so. For any convention one might take up, there will be an ingenious or ignorant construct to undermine it.

And this is also what Pop, and others, who deem language no more than transmission and reception of signals, are doomed never to be able to account for. — Banno

:roll: I guess you are demonstrating Davidson's point here by misconstruing my understanding? I am an Enactivist

That's the modern viewpoint on information (bits) but it's not what in-formation actually is. — GraveItty

:up: Yes, I agree. Information is an inForming - literally changing the shape of, including mind. Originally this would have been meant to apply to an immaterial mind, but If we accept neural correlates of mind activity, then it is a physical informing. And this physical informing is the fundamental stuff, imo. The way order in the universe self organized, and then life, cannot be via different processes, but via the same self organization of information process.

This "inForming" understanding of information can not be found in any of the dictionaries or Wikipedia anymore, but in several older texts, circa 1950, this is roughly how they describe it.

Thanks again for the excellent explanation. I feel I have heard these words before, but not as well articulated. Normally I would love to continue this conversation, but I have pressing matters to attend to. Thanks again.

Thanks for the great reply. I'm starting to get it. I'm always expecting to encounter some major unforeseen stumbling block, but you have given me another avenue of enquiry. I will research this some more. Gauge QFT is not at all intuitive. :sad:

BTW, Welcome to the forum. :up:

:rofl: So true!

I'm not sure what the connection with art is here. — GraveItty

We have strayed somewhat off course. Thanks for confirming.

I am working on the principle that information is fundamental. Whilst I can understand this logically, I can not verify it with physics. I wonder did you get a chance to look at the link? I wonder what standing such ideas have in physics circles?

From this you can maybe see how the equivalence comes to be — GraveItty

Unfortunately not. :smile:

So interaction is not information, but a prerequisite. — GraveItty

It depends on your definition of information. I am saying interaction is the equivalent of information for any two entities that are interacting. That information is a change causing interaction. It is a slightly different take on information. One can ask in what sense can an entity exist on it's own? And we find it can not, it can only exist in relation to something else, so can only exist in interaction / relation. If you pose a field as a fundamental, then it is you who is interacting with that field.

The way I see it is - when two wavicles interact they integrate their information.

Unfortunately I am not familiar with gauge QFT, so cannot reply in those terms.
However you seem to know your stuff, so if you don't mind, I would be interested in an opinion on the mass-energy-information equivalence principle

(n) The problem is how to escape from the circularity. On the one hand, I am conscious of something (an apple) and I interact with it. On the other hand, I interact with something (an apple) and become conscious because of it. — RussellA

I don't think you can escape this circularity, which is why I say information = interaction.

The Wave function is probabilistic, and is collapsed at the point of interaction. Consciousness exists at the point of interaction, and not outside of it. This illustrates the wave function collapse nature of reality, and suggests consciousness is probabilistic, until collapsed to a point. This would validate the notion that consciousness exists in frames - exists at the point of collapse of probabilistic information.

However, thankfully, new information has to fit old information, in a constructivist fashion. It has to fit existing informational structure. So having an existing body of information seems to keep things on track - to evolve in a deterministic manner, with just a slight element of randomness, to allow for emergent / novel thought, perhaps through Landauer's principle.

(n) Yes, at a large scale, the system may be static, but at a small scale, the system is dynamic. But I see no connection between a dynamic system and any consciousness resulting from such dynamism — RussellA

I think all systems are enmeshed and dynamic at all scales - they are moving and evolving always, due to codependent interactions. These interactions are equivalent to information. Certainly for sensing organisms these interactions constitute information. However, I do understand one can hardly understand this with the prevailing definitions of information.

It has been good to chat. :up: Unfortunately "reality" has intervened such that I will not have as much time for this for a while, and we have strayed quite a way off topic. :smile:

(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information" — RussellA

We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with. whether they be memory, imagination, or sense generated. When exactly consciousness emerges in those moments is hard to say, is it instantaneous, does it slowly resolve during the course of a moment, or crystalize at the end of a moment? I don't know, but I would say during those moments there is a multiplicity of interactions occurring, and they resolve to a singular picture somehow, that we know as consciousness - at that moment the information / interaction has been resolved. As you say, understanding information is important to this, and there is no singular, universally agreed upon, definition.

A deterministic system cannot be random, unless one brings in free-will — RussellA

Landauer's principle
It holds that "any logically irreversible manipulation of information, such as the erasure of a bit or the merging of two computation paths, must be accompanied by a corresponding entropy increase in non-information-bearing degrees of freedom of the information-processing apparatus or its environment". - Wiki.
This is something that may be relevant to consciousness. In the process of information, as an interaction of one part to another, there is an element of entropy which changes the deterministic nature of the relation, such that a tiny degree of randomness arises - perhaps this is what causes emergence?
Could Landauer's principle explain it?

Perhaps this is free will? :smile:

(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction. — RussellA

In my understanding, how the snooker balls exist outside of a moment of consciousness and thus an interaction with them, is probabilistic, no matter how certain we may be, as per Schrodinger's cat situation.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world. — RussellA

:up: So an interaction ( resonance )? Sounds like Enactivism to me?

That is an excellent post :smile: It is such a pleasure to find intelligent and probing conversation.

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. — RussellA

If this were true then we couldn't use information to explain anything, as everything is relative to a consciousness. IE: it is not art that we speak of but our consciousness of art - perhaps a concept that exists slightly differently in our respective minds, as per all concepts. So it is important to have definitions that we agree on, and to be able to pose concepts in the third person perspective ( in the empirical objective tradition), such that we can engage with the concept purely intellectually, and then incorporate it, or not, into our personal perspective.

We can pose a concept of how information works in the empirical tradition and then decide on whether this makes sense or not.

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder" — RussellA

Much of this speculation exists outside of a definition of information. If information is understood as evolutionary interaction, then the interactions that led to the forming of a photo diode could be understood as a creation of an informational body in a certain form, that interacts with other informational bodies of certain form, and they change each others form in the process of information / interaction. Posed this way we avoid the difficulties of understanding what another informational body in a certain form experiences. Which we cannot know for certain, but if elementary particles are formed due to forces acting on them, then surely they would be feeling those forces? They may not be able to feel those forces in a self aware sense as we do, but there are forces acting on them and they conform to those forces, as we do. Evidently some of those elementary particles eventually form amino acid molecules that self organize to life. Imo, this is deterministic with a slight element of randomness - it is consistent with the accumulative informational body theoretic - that informational bodies can continue to evolve in complexity.

Systems and complexity theory are near enough to a theory of everything.
In Systems Theory; everything = interaction
For a person: everything = information
Therefore interaction = information, where a person is a complex adaptive system.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder". — RussellA

I would say the beholder is a body of integrated information, and the latest state of this is consciousness, and if the latest information integrated is purely visual or auditory, and results in a pleasant feeling, then the chances are that we have witnessed or heard something beautiful. So yes beauty is in the eye of the beholder, but information is something different. If we understand information to be interaction, then information is the change causing interaction between an externality and the integrated body of information - a body that exists entirely as a result of past such interactions, from the biological, experiential, and relative perspectives.

In one respect it does not make sense to say a body exists as a state of integrated information as it is always interacting, changing, and evolving, but in order to deal with it, we need to conceptualize it at some level, and so I conceptualize it to moments of consciousness, that exist as states of integrated information, as per IIT. And then, in those moments of consciousness the information is resolved to some clarity, entirely from the perspective of the integrated information, or as you say the eye of the beholder.

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from.

Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ? — RussellA

Basically yes, but we have to bear in mind we have conceptualized consciousness to a state of integrated information. What you describe is a situation where that state is disturbed, and then reintegrated again. Fritjof Capra states "cognition is a disturbance in a state", and everything is a system in a state, according to systems theory. However there is a world of difference between the interaction of two molecules, and the interactions of 24 million molecules making up an average human cell, and then 30 odd trillion of such cells making up human consciousness. So we are talking about very different results indeed, however they are the same in terms of information having been disturbed and reintegrated.

In systems theory we can take any part of the universe, such as the biosphere and know that it is made up of self organizing interacting subsystems all the way down to plank length and perhaps beyond. For things such as rocks, they require a physical interaction for their total information to change, for sensing organisms however this physical change of state can occur due to a perception of a change in their environment.

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ? — RussellA

Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness.

1. Potential information exists in the book on a shelf

2. Actual information occurs when we read it - interact with it.

3. Consciousness occurs when this interaction is integrated with past informational structure - ( knowledge in constructivist fashion ).

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect — RussellA

Books on a shelf, etc, are an expression of your self organization, rather then the book's self organization. Leave the book in the weather for a time and then it will "self" organize. The organization I am referring to is intrinsic self organization. Everything exists as an evolving process of self organization, so changes over time, due to interactions, including rocks. Nothing stays still and permanent, in the absolute sense.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ? — RussellA

Yes in all these cases self organization has occurred. And you would be asking - if this is the case than who or what does the thinking? It is something I wonder about also. :grin: In my understanding, Information is self organizing, and thus self integrating. Interactions self organize to an integrated form, and all that exists, exists as an artefact of this process. The symbolic self is an artefact of evolutionary neuroplasticity.

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X — RussellA

Yes, the source of self organization is what does the thinking. Is it the anthropic principle - the combined laws of the universe causing everything to self organize? Is it god? This is where the philosophy gets interesting. Once you decide on the source of self organization, you close off other possibilities and commit yourself to a theory of everything which forms your reality.

In Yogic logic ( my interpretation ) the source of self organization is consciousness. This is a wise move, where consciousness is left as something undefined and fundamental - where everything and everybody is, at heart, made of the same stuff, just different in Formation :grin: Reality here has infinite potential, it can continue to evolve beyond what can currently be conceived, and the self organizing information theoretic remains logically coherent.

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness. — RussellA

Yes, that is how I would describe it also. The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. Absolutely everything can be described in the same terms, as form resulting from historical interactions. If we understand these interactions as information ( where information is an inForming ), then everything can be described as an evolving informational body, where the latest form of said body is it's integrated information, and integrated information is equal to consciousness. Obviously our consciousness is far more complex and far more advanced then a sand dune so far more conscious, but it results from the same informational / interactional process.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism. — RussellA

The quantum foam lacks form, as it is random and probabilistic, however once a wavicle integrates it's information with another wavicle, then the informing process begins and can continue to amass to elementary particles, atoms, molecules, and so on. The pattern of the physical arrangement of the atoms
gives rise to different materials, or forms. In the end all these different forms emerge, but from the same process.

Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence. — RussellA

:up: Yes, or put another way - it is a self organizing universe, but what is the source of self organization?

"I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions — RussellA

:up: Yes, these expressions are idiomatic to my evolving understanding of information and consciousness. They are based on established theory, but my personal interpretation of it. You have agreed with more than I would normally hope for, so I am pleased overall.

As you say, in communication, some degree of charity is necessary, and given some charity I think the definition would normally pass. However I wouldn't normally expect charity in regard to a "definition" of art, so I had to test the definition by developing a deeper understanding of both consciousness and information. Both neglected and contented concepts in western thought. It turns out they are related concepts, in that consciousness at any moment is a state of integrated information, that exists as an evolving process, for the purpose of self organization. Again this is not a universal understanding, but idiomatic to my personal understanding of Systems Theory, Constructivism, Enactivism, IIT, and aspects of Yogic logic, and the emergent understanding that information is fundamental - which will, imo, challenge a lot of established understanding about information, amongst many other things.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment. — RussellA

:up: Yes, that is a good way of putting it. @Gnomon illustrates something similar here.

evolution cannot be driven by information — RussellA

It depends on what you understand information to be. Incredibly in this "information age" we do not have a universally agreed upon definition of information. :grimace: I have understood information to be equal to interaction. In the sand dune analogy, all those gazillions of interactions that eventually self organize to a sand dune are information. Ie: information is identical to interaction, and can be thought of as evolutionary interaction. This might explain it better, and this.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42) — RussellA

Kantian idealism would probably agree with the understanding that everything is information, although he couldn't have been aware of the neural correlates of perception in his time, so would have probably understood information as something changing an immaterial mind. If we accept neuroplasticity and the idea that perception entails a physical change in brain state, then all information can be understood in a universally applicable and regular way - as a change causing physical interaction. This message is not something you can passively just receive - initially it changes your brain state, which causes further neural interaction, until the process resolves to some clarity.

To illustrate just briefly: My physical brain state, causes a change to the physical keyboard state, which causes a change to the computer hardware state, which causes a change to various internet routers, which cause a change to your device, which causes a change to your brain state. So information is a "change causing interaction universally", in my understanding.

The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.
IE, how can consciousness interact with itself. — RussellA

This is what Enactivism tells us.
"Enactivism is a position in cognitive science that argues that cognition arises through a dynamic interaction between an acting organism and its environment.[1] It claims that the environment of an organism is brought about, or enacted, by the active exercise of that organism's sensorimotor processes. "The key point, then, is that the species brings forth and specifies its own domain of problems ...this domain does not exist "out there" in an environment that acts as a landing pad for organisms that somehow drop or parachute into the world. Instead, living beings and their environments stand in relation to each other through mutual specification or codetermination". - Wikipedia

What information is , is a huge and contended topic in itself. I have understood it as an interaction, consistent with enactivism, and systems theory.

Sketched roughly and simply: Information causes a change in neural state. When we look in any direction, we see a picture already coloured in and symbolized subconsciously, whilst science tells us that no colour exists in the external world. We then interact with this symbolized picture. In cognitive science, a Markov blanket presents us with this initial perception, and then other similar processes act on this in a sequential fashion to eventually arrive at some resolution . This reveals how it is then quite easy to insert imagined or memorized input into the process rather than external sense derived information, and how consciousness is the result of this information processing and integrating. In short it makes no sense to think of an organism absent of it's environment, and likewise it makes no sense to think of art absent of the artist, or as you point out, the observer. We need that interaction for information to occur, and in the process of integrating that information consciousness occurs, and clarity about what is going on emerges, and action results, etc. The information flows in this way, as I envision it, due to interactions, and the result is that everything is enmeshed, codependent, codetermined, and coevolving, on absolutely all scales.

Perhaps this remains the sticking point, in that I tend to Modernism whilst you may be leaning towards Postmodernism. Both valid as definitions of art, but different.

Within Postmodernism, an artist has total freedom to create whatever object, concept, performance they want for it to be called art.

Whereas in Modernism, regardless of the definition of art, some objects have artistic value and some don't, where someone who makes an object with artistic value is an artist and someone who makes an object lacking artistic value isn't an artist.

IE, personally, I don't agree with the Postmodernist definition of art, because the words art and artist lose all meaning, as everything can be art and everyone can be an artist. — RussellA

This definition can be used to argue that art only has one definition, and that it is valid across all cultures for all of time, as it identifies a logical constant in art, which is it's most important consideration, and without which art could not exist. So it can be used to argue that art has a definition in Post Modernism. This would put a spanner in the works of some post modern thinking, as it would identify how it is incoherent to believe art is for art's sake, as it is always information about the artists consciousness, regardless of whether they understand this to be the case or not. Anybody can deem an object to be art, but they can not engage in this activity beyond what their consciousness allows, so this identifies a limit to what art can be for any particular artist. We need to bear in mind that art has infinite potential, as an expression of a potentially infinite consciousness, but it only ever comes in finite form.

Art can not be defined externally via form, as it is potentially infinite, but it can be defined internally via the process that leads to it's creation, and how this places a limit on what it can be. We can define art by what creates it, rather then it's eventual result.

The only thing that is constant in art is that it is information about the artists consciousness – everything else is variable and open ended. It takes some appreciation that this is the only thing tying one piece of art to another in the absolute sense. The unearthed ancient artefact and a Pipilotti Rist light show have this in common, these are expressions of a person's consciousness in regard to art, at particular times in history. In the future, art might be expressed directly via a Neuralink type of device, but it will still be captured by this definition, no?

Consciousness is unique and particular. It is made of information - from DNA information, experiential information, and perspective (relativity). This information, composes an individual, and they can do nothing other than express this information. They do so when making art. Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. The information in the artwork is understood in terms of the information possessed by the observer, to create what we normally call consciousness. If this is so, then where is the sense in trying to separate the artwork from the consciousness of it's maker? There is no sense in this is there? If the observer is completely enacted / interacted in the artwork, then the maker is surely more so. So what is the art work an expression of in all cases?

There is a neat trick to illustrate the Enactivist cognitive interaction: Thesewordsandyouareone - for a brief second these words and you are one - there is no possibility to separate you from these words as you read them - your consciousness, at present, is made up from the interaction of the information that composes you and these words. Apply this logic to the making of an art work, where there is no difference between and artwork and the consciousness of it's maker for an extended period of time, sometimes years, and it is easy to see how art is always an expression of consciousness, and how this internally defines it, in the most pertinent terms. And how all other considerations are miniscule and trivial compared to this one.

Good luck with it. :up:

Yes. Any single isolated thing is meaningless. The meaning is in relationships (e.g. ratios ; values). So, if you put two Bits together, the result many be an "interaction". Therefore, the basic element of meaning is the Byte -- an ensemble of bits; a system ; an integrated whole. — Gnomon

:up: Yes something like this. The interaction self organizes, or integrates, to become a self in some way. Similar to the sand pile, and similar to Wolfram's automata. Lots to consider now - thanks.
Self assembly.

The real issue for me is that this understanding of information ( If we bundle the above definitions into one ) is really quite divergent from the normal understanding, which is various and situationally specific. I have now read more papers than I can remember, and I would estimate only about 30% of the definitions of information focus on interaction, and change in mind state. I find this hard to understand as a change in mind state seems to be the obvious necessary element of information, and this would be a systemic interaction.

in order to define something you need to specify it’s unique attributes — praxis

Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness. — Pop

Why is this so hard for you to understand? -"Art’s only necessary distinction from ordinary objects is the extra deemed art information". Once something is deemed to be art, my definition comes into effect. Please read the definition and the earlier posts before posing the same question again.

Completely in character, Pop completely ignores the fact. — praxis

:roll: For the tenth time, and it is the first paragraph of the definition.

Proof of the definition:

​1.   Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness. — Pop

The new Atom is the Bit. — Gnomon

But a bit is not meaningful. We need a meaningful bit. When I first started this thread, I looked through all the dictionary definitions of information, and none were satisfactory. It was only several weeks later that I happened upon the Information philosophers old time definition - to inform - literally change the shape of. If we take this to be the definition then information is not something static, but something dynamic, that exists as a change causing interaction.

The definitions that we have are:
1. Enformation
2. To inform - literally change the shape of
3. The evolutionary interaction of form.
4. Evolutionary interaction.

If we bundle all these together, we get: the evolutionary interaction of different forms of energy, maybe?

If we accept that information is fundamental, then information is everything. The only other thing that is everything is energy, and matter - as different forms of energy. These different forms of energy exist as systems in an enmeshed, and interacting, and evolving process. This includes mental systems. So interaction is also everything.

Therefore information is the interaction of energetic forms? There must be some counterarguments??

FYI: An information theory of individuality

IE, as art is information about consciousness, and the only consciousness that I know exists is my own, art can only be information about my own consciousness. — RussellA

I'm glad we agree that art is information about the artist's consciousness. And when we view art, we do so in terms of our own consciousness. And so when we view an artwork it is an interaction of one consciousness and another, and when these two click, it is one of the best experiences life has to offer.
When they do not click however, then it is another story altogether.

This is what I hoped the definition would highlight, not that one consciousness is better than another, but that a similar consciousness will agree on the form of an artwork, whilst a dissimilar will disagree.

Yes, as your own consciousness grows, as you learn more about any particular artist, or movement, your ability to appreciate them improves. Your ability to asses whether they achieve their aims, and whether their aims have merit, improves.

Most of the time the artist and the viewer draw their information ( which when integrated makes up their consciousness ) from the same collective consciousness ( culture ) so they will understand each other to some extent. But when knowledge of any particular area evolves beyond normal understanding, then a discord occurs. This occurs in all areas, not just art. At some stage the specialist's understanding becomes incomprehensible to normal understanding. Andre would seem to be such a specialist - in an extremely obscure and abstract area of sculpture. Clearly these forms mean something to him, but I don't know anything about him or his thinking so would not like to say more.

Many artist's reach a stage of development where they can no longer be understood by the norm, so they give up totally on that aim. They would still be understood by a handful of people with similar interest and understanding, so they speak to them. To me, this is nothing but a story of how different their consciousness is to the norm. How different is the information that they present compared to the norm. How they don't care about this, or how they do this on purpose in order to differentiate themselves from the norm. And this speaks of little other than how they understand themselves and the world that they live in, and how this is a part of their personality and larger purpose in life.

The information is not so much in the brick, but in the fact that a person who has total freedom to do as they like, chooses to put a brick on a pedestal. This speaks heaps, imo.

David Shrigley, Nobody 2007
https://cdn.artimage.org.uk/production/19/8/19800-842.jpg

So I wonder, is there a statement that explains all information? — Benj96

Everything is information, from every perspective. :cool:

When someone observes information, the information can only express something to the observer if the observer can make sense of the information, can see patterns in the information, in that the information is not chaotic. IE, information by itself cannot express anything to the observer until the observer is able to see patterns in the information.

The patterns the observer is able to see is a function of the observer's mind, the observer's consciousness, and is not a function of whatever caused the figurine to come into existence.

IE, seeing art in the figurine is an expression of the observer's consciousness rather than any history prior to the creation of the figurine. — RussellA

Oh, I see now. You are highlighting that the observer interprets the artwork entirely in terms of their own consciousness, and If they had no prior knowledge of art history, they would hardly be in a position to interpret anything. Similarly, If this sentence was written in Swahili, you would not be in a position to understand it. Yes, I agree entirely with this.

In my understanding, information has a chronological progression. It is causal, and I was trying to illustrate this. How the artist informs the work, and the work informs the viewer, and so on. But certainly if the viewer can not understand anything of the work then they are likely to dismiss it as something irrelevant to their understanding, and purpose. :up: ** Likewise what they understand, they understand in terms of established knowledge, or understanding.

Postscript to my previous post about the "self-organizing" function of Information. In the same book and chapter, philosopher Rolston mentions "autopoiesis" (self-creating) in passing. That seems to be a more provocative term, in that it could imply a teleological tendency, intrinsic to the mechanism of evolution, toward the emergence of self-aware entities. Such organisms are "unique" in the universe, which remains -- after all these years of incremental evolving -- mostly inorganic, and unaware. — Gnomon

Yes, we come from a tradition of thinking of ourselves as the chosen one's at the center of the universe, tended by a benevolent god, etc, and this sort of thinking is so hard to break free from. Yet the idea that information is self organizing certainly puts a spanner in the works! Indeed if information is self organizing, and I am convinced that it is, then who does the thinking? I think what we have to say is that what we are is integrated information, and this body of integrated information does the thinking. In this sense a self is an artefact of this process, consistent with enactivism, and evolutionary psychology, and slightly beyond autopoiesis, to self organization. Varela would "never say self organization", as even autopoiesis was radical in his time. But I think the time is ripe, and in so doing one virtually obliterates all previous philosophy, and in it's place one gains a theory of everything as self organizing informational bodies. Life and consciousness emerge and evolve along with the complexity of information integrated - everything is solved - end of enquiry - How do you like it? :lol:

This is simple and rough indeed, but it does seem to be where information philosophy is heading. What are your thoughts?

There is a flow of information - but in what direction ? — RussellA

This is not the ideal thread for this, but since you asked, the nature of information is something I am still trying to understand. However thus far I understand it to be something that is accumulative and irreversible - It's direction of momentum can be altered but not be reversed, thus everything evolves as an accumulative informational body.

Just roughly, the artist is informed by experience, and in interacting with the art work inForms it, likewise the medium informs the artist - that there is a limit to their ability and skill :smile: Something is created , and then this something is interpreted by the viewer. Suppose this something is an archeological artefact, a figurine, quite a lot can be inferred about the thinking of the person that made it, depending on what is depicted and how and from what materials, within the historical context that it was made in. If this figurine is not information about the mind activity that created it - what then is it information about? We know it is information, since everything is fundamentally information.

This same situation applies to all art ever made, and all things ever made. However as you point out, context makes a difference, but once we account for this, the art is still information about the artist's consciousness, just in a different context, no?

Information flows between the maker of the artwork and the artwork, and from the maker of the artwork to the observer of the artwork by-passing the artwork entirely, but cannot flow from the maker of the artwork to the observer via the artwork. — RussellA

No, this does not make sense in my mind. The information flows much the same as this message. I inform the message, and then you interpret the message. In the process you receive a sense of how my mind works, and visa versa.

1) Some artworks have two or more makers, such as the collaborative work of Ruth Lozner and Kenzie Raulin. To which mind does the artwork have insight into ? — RussellA

In reality, mostly to the dominant one. But for political correctness lets say their combined thinking.
All of your point form arguments relate to the difficulty of discerning the mind activity of the artist from the art work alone - yes it is very difficult, and often requires some historical knowledge of the artist and the context that the work is created in, but this does not negate the definition. The artist, or a non artist person, can express nothing other than their consciousness. Consciousness is used as a blanket term for mind activity, but if we look into it more deeply, consciousness is an evolving process of "self organization" of an individual. In science "self organization" led to life. In Systems theory, the universe is bottom up "self organizing". So art expresses the same "self organization" that ordered form in the universe expresses - that life expresses, this is a big deal, imo, and this is not going to change anytime soon. :smile:

Before it is art, it has to be deemed to be art.
— Pop

Suppose a person is conscious of the information arriving through their senses from two objects in the world.

For what reasons would that person deem one object to be art and the other object not art ? — RussellA

Ha, ha. This is something you would have to ask the person deeming one object art, and the other one not. But there would be reasons, or in other words something about their state of mind or thinking ( consciousness ) would result in such an action. Because consciousness is "integrated information", the choices people make are congruous with their general state of mind, so when they make the choice that something is art this is an aspect of their general mind activity, and in an ideal setting we should be able to infer a lot of their mind activity from the clues provided in what they choose as their art. This of course is an ideal situation I'm describing, that cannot be achieved completely, but this is exactly what happens in that Van Gogh clip provided earlier. Even to the extent that Van Gogh is judged to be one of the best people to have ever walked the earth.

I should do some art criticism threads, to explore what can be inferred about the mind activity that made the work, from the work alone. Do you think something of the sort would be of interest?

Without memory our body mechanisms would fail. We would not survive — Benj96

Yes that is true. And we do have a memory of past moments of consciousness, which I would call a body of information, and it is this body of past information ( made from previous experience ) that we are, and then we incorporate new information ( which is the change that we notice ). This way the body of information grows, and consciousness is the latest state of this.

Be warned however, this is my personal understanding. It is how I have come to understand it. I think it would be the understanding that underpins IIT but I am not sure.

Importantly there is an element of randomness that accompanies the collapse to a moment of consciousness that is descrbed by:

Landauer's principle
It holds that "any logically irreversible manipulation of information, such as the erasure of a bit or the merging of two computation paths, must be accompanied by a corresponding entropy increase in non-information-bearing degrees of freedom of the information-processing apparatus or its environment". - Wiki.

This is something that may be relevant to consciousness. In the process of information, as an interaction of one part to another, there is an element of entropy which changes the deterministic nature of the relation, such that a tiny degree of randomness arises - perhaps this is what causes emergence?
Could Landauer's principle explain it? — Pop

But an actuary table is not art, and a Matisse CutOut is art. Therefore there must be a conscious act of determining what is art and what isn't. If whatever created the object is irrelevant in the recognition of the object as an artwork, and the object itself cannot determine that is an artwork, then the conscious act of determining the object as an artwork must be in the observer.

But the observer only knows that the object is an artwork by recognizing it as an artwork, regardless of the intentions of whatever made the object.

IE, looking at the object as an artwork is an expression of the ability of the observer to recognize an object as an artwork, rather than any expression of the observer's ability to look into the mind of whatever made it. — RussellA

An actuary table can be deemed to be art, since Duchamp's urinal, but not before, and this reflects how our collective consciousness has evolved. Before it is art, it has to be deemed to be art. The person deeming it to be art is the artist. If you find something on the ground and pick it up and put it on your wall as an art work, thus deeming it to be art, then you are the artist. Your mind set sets you apart from all those others who walked passed the object not noticing it or thinking it rubbish. So it is still the same situation - You made the choice that this is art, and the artwork in some sense represents your mindset - your consciousness.

This would not have been possible in Jane Austin's England. If you hung a piece of rubbish on your wall - you would be carted off to the nut house. You could only hang ideal landscapes, or if you could afford it portraits. And Sir please refrain from hanging any radical romanticism - what on earth are you thinking of, do you wish to bring down the social order? :lol:

My point is that consciousness evolves both collectively and individually and art reflects this. Consciousness has infinite potential, and although at any time we think we are well on top of it, we are always only scratching the surface. Currently there is potential for a major shift in paradigm through the realization that information is fundamental. This will eventually lead to panpsychic paradigm, not any time soon of course, but the smart cookies can see it coming, so are positioning themselves, imo. There is enormous potential for new art through this understanding, and, If this is somthing that interests you, then it is something I would encourage you to consider.

Aha - you are arguing for a mind independent time? This would be a form of naive realism? Yes, this is the paradigm the world works in. Einstein's relativity however says we each have our own relative space time, and he made the point that time is a stubborn illusion. I always had difficulty understanding this until it dawned on me that a moment of consciousness is overlapped by the next moment of consciousness, and the difference between the two creates a difference of time. All the while the clock on the wall keeps ticking, but this is irrelevant for us until we look at it. Thus in that moment of consciousness when we check the time, time has passed since we were last conscious of it.

I am trying to elucidate time in the "first person perspective", where moments of consciousness of time is what is relevant to the passage of time. You are applying a "third person realist" perspective to this and so the two do not agree. In line with relativity, your mechanical measure of my time will not agree with my mechanical measure of my time, provided that we are traveling at different speeds. So who's time is right? Einstein decided that it was relative to the first person, which seems reasonable?

It's a good question, and a hard one to answer. We can pose concepts in the third person, but we can only ever experience in the first person. The "experiential" element is messed up in the third person perspective, so is not equally "real" to the first person perspective, imo.

From the empirical point of view time passes independent of everything and everyone, but from my point of view this requires a consciousness to construct such a paradigm through which to view the world through.

This is where you have to comes to terms with reality: The only non quantifiable theory of information there can be, is the art experience itself. You have, in my thoughts, arrived at the critical point: To the extent that a theory is non quantifiable, it is the very embodiment of the quality it is supposed represent. I wonder, what could this be? A poem? Or am I completely missing something? — Constance

There is truth in this, but it is really the wrong thread for it. Note my definition does not define the form of art, experience, or consciousness - these are left open ended. It defines art in terms of what leads to it, and how this is what it expresses - namely integrated information.

Regarding the broader implications of your statement: Stuart Kauffman: "In POE we argued that Shannon’s [2] classical definition of information as the measure of the decrease of uncertainty was not valid for a biotic system that propagates its organization. The core argument of POE was that Shannon information “does not apply to the evolution of the biosphere” because Darwinian preadaptations cannot be predicted and as a consequence “the ensemble of
possibilities and their entropy cannot be calculated [1].” Therefore a definition of information as
reducing uncertainty does not make sense since no matter how much one learns from the information
in a biotic system the uncertainty remains infinite because the number of possibilities of what can
evolve is infinitely non-denumerable. I remind the reader that in making his definition that Shannon
specified that the number of possible messages was finite."

Shannon information does not apply to biotic or natural systems, since they are endlessly variable and open ended. Biotic systems are more like evolving bodies of information, where consciousness is the latest state of integrated information, and this would always be experiential.

Energy and matter are just place holders for metaphysics, as I see it. Information presupposes these, just as it presupposes metaphysics. — Constance

:up:

Dissecting landscape art history with information theory 2020 — RussellA

Thanks for the link, I wasn't aware of it. Shannon information theory can quantify information ( produce a number ), but it is not meaningful in any ordinary sense. I am looking for a theory of meaningful information, of which Pierce's theory of pragmatic information would be close, but also Integrated information theory as a definition of consciousness is good. I believe, there is opportunity to create a theory of information, since no single satisfyingly theory currently exists.

This emergent understanding of information was critical to this definition of art. Wit could not find something singular that all art is, and in his time information was something one exchanged with the neighbors over the back fence. We now know definitively that all art is information - since information is fundamental. The only question that then remains for art is - information about what? And the obvious answer is consciousness. The term consciousness captures the mind activity that leads to the creation of art, and how the art is limited only by the consciousness that creates it - which when we look at art across cultures, and through the ages, seems so obvious. To me at least - :lol: - but it has the consequence of ruffling feathers, since we all know exactly what art is! - right?

The artist interacts with the medium such that he inForms it. The medium in turn informs the viewer. the viewer in turn informs somebody or something else, etc. This is roughly the information flow, and the end result is a change in form of somebody or something - don't ask me more - still trying to work it out myself. :smile:

We may have begun to understand evolution as the marriage of selection and self-organization". Which is the function of what I call EnFormAction. :smile: — Gnomon

:up: In General systems theory we can take any part of the universe and know that it is a self organizing system made up of self organizing subsystems all the way down to plank length and possibly beyond. It is a bottom up self assembling universe, and physical interaction is information, then this is modified somewhat for sensing organisms, in that they can be changed physically from afar due to interpretation of changes in their environment, normally called information.

https://thephilosophyforum.com/discussion/comment/591498

Is Norbert Wiener's 1950 The Human Use of Human Beings: Cybernetics and Society relevant to your position - where art is just a part of patterns of information within the world ? — RussellA

Cybernetics is part of the enquiry, and is something I have only begun to research about a month ago.
It seems about this time we lost the traditional definition of information - which is to inForm - literally change the shape of, including shape of mind. This definition of information is not present in any of the dictionaries or Wikipedia, which presses my paranoid buttons.

Information and it's definition is an enormous topic. That it is something fundamental - equal to energy and matter, and challenges all understanding.

Such a concept even applies to the preservation of the self in time: how much is actually preserved of this constructed self in the transmission of self in time from past through to future? The self is in decay, or, each moment is an entropic loss of the previous, and perhaps a reconstruction: the self is thereby defined as a fluid reconstruction of information, what Husserl called predelineation: We live in an adumbration of the past that is presented in eidetically formed predicated affairs, to use his language. I find this interesting, and perhaps I will look into it. — Constance

The idea of the mass - energy - information equivalence principle is picking up steam, and understanding things as an evolving process is the obvious way forward. All of that philosophy you mentioned was conceived at a time before it was understood that information is fundamental, so there is an awful lot of philosophical meat on offer, in reinterpreting it via an information theoretic.

My trouble, as I read through this, is that it is entirely a quantifiable analysis. Aesthetics is not quantifiable, — Constance

That particular theory uses Shannon information theory, but others, including myself, are looking toward a non quantifiable theory of information, where information is a fundamental non-quantifiable observable.

This is why your announcement that art in information offends others here. They think art is profound, religious, or deeply meaningful. Others look to the meanings in play, how truth connects to images, how images are iconographic reflections of the self; and so on. — Constance

Many would not understand information or consciousness beyond their dictionary meanings. I think the one's that do have no problems with the definition. Academia is coming around to the understanding that information is fundamental - is equal to energy and matter. As this understanding grows so will understanding of my definition, I don't expect this any time soon of course. :lol:

To me, it is a bit like looking at the human condition and its most meaningful dimension, and saying, well, what does the actuarial table say? You may be right, I mean, the table might be a true account. But how is this quantitative account even remotely adequate? — Constance

It needn't be about actuarial tables at all. Nothing changes for human Being, other than the understanding that everything is information, from every perspective. It is a little like Wit's word game, but a notch deeper to become the information game - both physical and mental.

Pop, TC's not the only one here who thinks your idea is empty. But don't make it about him. Abusing the man isn't an argument. — Tom Storm

Your mate thinks he is entitled to troll this thread with vacant opinions, as if it was a facebook post or something. It is very low standard, and can hardly be called philosophy. It must be the fifth time he has made the same vacuous comment. I think I have been very patient in my response to people although most of the time the OP answers their questions, provided they make genuine enquiries. But I will not tolerate histrionic whinging and whining, or backhanded derision without reciprocating.

Your mate did not understand what a scientific definition of art even means. It means that the definition is relevant for all art ever made, regardless of culture, from the furthest past, to the most distant future. It also means it can be easily falsified - you can provide a work of art which the definition does not capture. I point out in the definition proof that this is not logically possible, and I would have thought most people of normal intelligence would understand this, but it seems not.

I'm sorry you find such things as a scientific, irreducible, and falsifiable definition of art empty, but I am aware of flat earthers, Q Anoners, New world orders, etc, so nothing much surprises me.

Not to provoke, but just a quick note: this cart before the horse? The real construction of horses and carts lies in the hor-ca-se-rt. This is phenomenology. Dewey was close to this, but like I said, he missed the boat...or cart. — Constance

Not really sure what this means. Nevertheless, I am impressed with your energetic, and enthusiastic, philosophy. If you don't mind, I would like to tell you why I hold the fort pretty well. My understanding is based in systems theory, constructivism, enactivism, integrated information theory, and yogic logic. Half of these are main stream science, and the other half are about to be, and Yogic logic agrees with a lot of it. They have an information theoretic running through them, which I am in the process of understanding. They create a picture of everything existing as interactive systems and subsystems in an enmeshed and interdependent evolutionary process. This mix of theoretical understanding unifies and integrates very well, and can be used to understand almost any system or situation, from complex financial systems, to tiny simple microorganisms.

As I see it, most contemporary understanding is based on a mix of these theories, spiced up with insight and data from here and there. Such as this theory of individuality released last year. Unfortunately most understanding on this forum is rather old - being based on old philosophy that did not have the benefit of these theories, or the contemporary view that information is something fundamental. Most of this older philosophy is fundamentally flawed in this way, and as a result so is the understanding that is based on it. This is largely my opinion, which I thought I'd share with you if you are interested. I thought it might be something you might want to look into as a way to strengthen your philosophy, by expanding it to incorporate an information theoretic. Of course it is hardly my place to tell you what to do. :smile:

All things have their foundational grounding in the aesthetic dimension of our existence, for as Hume said of reason, the same holds for information: in itself, it is empty. — Constance

I would agree that all things have their foundational grounding in experience, which is inherently aesthetic ( is painful or pleasant ). But we can not put the cart before the horse. Before we can have value, or meaning, or aesthetics, we need information - as information is the fundamental observable. It is the first thing we have, through which the other things - value, meaning, etc, emerge and evolve.

I think, we are not so far apart, except perhaps in this understanding of fundamentals.

It's embarrassing. — T Clark

What is truly embarrassing is how a dim wit and lack of any substantial argument whatsoever, will not prevent some from expressing their consciousness, mistaking their opinions for something of philosophical worth, like royalty. :lol: Far out!

Most people would understand the first time, but it seems you need to be told again - put up or shut up!