Completely in character, Pop completely ignores the fact.
— praxis

:roll: For the tenth time, and it is the first paragraph of the definition.

Proof of the definition:

​1.   Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.
— Pop — Pop

For the eleventh time, in order to define something you need to specify it’s unique attributes. Your definition only identifies information, human consciousness, and social constructs, nothing specific to art. It is not a definition of art and has no explanatory power in regards to art.

IE, within modernism are many different approaches, as with postmodernism, but for me the primary dividing line within art is the presence or absence of the aesthetic. — RussellA

Interesting. Are you someone who thinks art has a responsibility?

Does your perspective risk a subjectivist aesthetic? Is all post-modern art free of aesthetic merit and how does one go about identifying what counts as the aesthetic and what does not?

Post-modern work is likely to have an aesthetic, it just doesn't concern itself with beauty. Modernist (capital M) work like Braque's Cubism has an aesthetic too, but is it beautiful? Cannot something which is 'ugly" (however you define this) not also provide a profound aesthetic experience?

Can you clarify how you would apply your modernist perspective to pre-modern era work? Say a Titian.

Martial arts is a skill. Painting, Drawing, Sculpting, Creating Audio, or what I call 'special arts', are also skills.

Is there a definition for playing darts? Darts has a definition, but literally playing darts is a skill set which goes undefined.

That rules a majority of the answers in this thread as false.

A painting is a painting, a sketch, a sketch.

Therefore art has no definition; the term art generalises martial art (art style) and special art (art craft). A worthy art term is a philosophical subject matter where we are discussing both art style and art craft.

Art, defined is, the subject matter of martial and special art skills.

Is there a definition for playing darts? — Varde

Yes. The very clear rules of what constitutes a darts game. There is even a darts regulation authority.

or what I call 'special arts', are also skills. — Varde

Just because you call them 'special arts' means little to the rest of the world.

Therefore art has no definition — Varde

There is a long tradition of aesthetics that would say otherwise. It would probably be more accurate to say there are many, many definitions of art and no agreed upon canonical definition.

Martial arts is a skill. Painting, Drawing, Sculpting, Creating Audio, or what I call 'special arts', are also skills. — Varde

But one traditional issue in art criticism is how to identify the art as opposed to the skill. Technical skill is often seen as sitting separate from whether something has artistic merit. Pulp fiction author Stephen King is a writer of great technical skill but few would call his work 'art'. Also how do you separate art from craft? Another traditional distinction.

in order to define something you need to specify it’s unique attributes — praxis

Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness. — Pop

Why is this so hard for you to understand? -"Art’s only necessary distinction from ordinary objects is the extra deemed art information". Once something is deemed to be art, my definition comes into effect. Please read the definition and the earlier posts before posing the same question again.

Why is this so hard for you to understand? — Pop

Why is it so hard for you to be honest?

Xuit is an ungrounded variable mental construct: Objects are arbitrarily deemed to be xuit. Xuit’s only necessary distinction from ordinary objects is the extra deemed xuit information. Xuit can be anything the xuitist thinks of, but this is limited by their consciousness. — “Alter-Pop”

What is Xuit? You don’t know because I haven’t defined it.

Good luck with it. :up:

Xuit has nothing to do with luck. Go ahead and take another guess.

Perhaps this remains the sticking point, in that I tend to Modernism whilst you may be leaning towards Postmodernism. Both valid as definitions of art, but different.

Within Postmodernism, an artist has total freedom to create whatever object, concept, performance they want for it to be called art.

Whereas in Modernism, regardless of the definition of art, some objects have artistic value and some don't, where someone who makes an object with artistic value is an artist and someone who makes an object lacking artistic value isn't an artist.

IE, personally, I don't agree with the Postmodernist definition of art, because the words art and artist lose all meaning, as everything can be art and everyone can be an artist. — RussellA

This definition can be used to argue that art only has one definition, and that it is valid across all cultures for all of time, as it identifies a logical constant in art, which is it's most important consideration, and without which art could not exist. So it can be used to argue that art has a definition in Post Modernism. This would put a spanner in the works of some post modern thinking, as it would identify how it is incoherent to believe art is for art's sake, as it is always information about the artists consciousness, regardless of whether they understand this to be the case or not. Anybody can deem an object to be art, but they can not engage in this activity beyond what their consciousness allows, so this identifies a limit to what art can be for any particular artist. We need to bear in mind that art has infinite potential, as an expression of a potentially infinite consciousness, but it only ever comes in finite form.

Art can not be defined externally via form, as it is potentially infinite, but it can be defined internally via the process that leads to it's creation, and how this places a limit on what it can be. We can define art by what creates it, rather then it's eventual result.

The only thing that is constant in art is that it is information about the artists consciousness – everything else is variable and open ended. It takes some appreciation that this is the only thing tying one piece of art to another in the absolute sense. The unearthed ancient artefact and a Pipilotti Rist light show have this in common, these are expressions of a person's consciousness in regard to art, at particular times in history. In the future, art might be expressed directly via a Neuralink type of device, but it will still be captured by this definition, no?

Consciousness is unique and particular. It is made of information - from DNA information, experiential information, and perspective (relativity). This information, composes an individual, and they can do nothing other than express this information. They do so when making art. Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. The information in the artwork is understood in terms of the information possessed by the observer, to create what we normally call consciousness. If this is so, then where is the sense in trying to separate the artwork from the consciousness of it's maker? There is no sense in this is there? If the observer is completely enacted / interacted in the artwork, then the maker is surely more so. So what is the art work an expression of in all cases?

There is a neat trick to illustrate the Enactivist cognitive interaction: Thesewordsandyouareone - for a brief second these words and you are one - there is no possibility to separate you from these words as you read them - your consciousness, at present, is made up from the interaction of the information that composes you and these words. Apply this logic to the making of an art work, where there is no difference between and artwork and the consciousness of it's maker for an extended period of time, sometimes years, and it is easy to see how art is always an expression of consciousness, and how this internally defines it, in the most pertinent terms. And how all other considerations are miniscule and trivial compared to this one.

Lots of questions.

Are you someone who thinks art has a responsibility? — Tom Storm

No. Neither Derain nor Derain's La Rivière bear any responsibility, no more than an apple sitting on a table bears any responsibility. Though the Derain provides an opportunity.

What the Derain does give is a glimpse that there is something deeper and more profound than what is seen on the superficial surface of shapes and colours, of a figure walking past a house next to a river. The painting achieves this using an aesthetic form of pictographic content. What is hidden is not explained, but what is explained is that there is something hidden.

The aesthetic of art is what separates an airport novel from a Hemingway. Superficially,The Old Man and the Sea is a simple story of Santiago, an ageing experienced fisherman, but concealed beneath the words is a complex allegorical commentary on all his previous works.

We are muggles innocently walking along Diagon Alley, unaware of a hidden and mysterious and magical world just out of our reach, hidden by many powerful spells of concealment, seemingly lacking a key. But with art we do have the key. The key is our innate a priori ability to experience aesthetic form, an ability to discover pattern in seeming chaos, enabling the search and discovery of new understanding and knowledge.

Does your perspective risk a subjectivist aesthetic? — Tom Storm

I have the subjective experiences of seeing the colour red, hearing a grating noise, tasting something bitter, smelling something acrid, perceiving aesthetic form. These are not risks to my perspective, these are what I am.

Modernist (capital M) work like Braque's Cubism has an aesthetic too, but is it beautiful? Cannot something which is 'ugly" (however you define this) not also provide a profound aesthetic experience? — Tom Storm

Exactly. Aesthetic is used as an adjective and as a noun.

Aesthetic as an adjective is the study of beauty.

But beauty as a noun surely has a different meaning to aesthetic as a noun. For example, taking the examples of Picasso's Guernica 1937, a moving and powerful anti-war painting, and Bouguereau's 1873 Nymphs and Satyr, mythological themes emphasising the female human body

Dictionary definitions generally agree that aesthetic as a noun means a set of principles governing the idea of beauty, such as "modernist aesthetics" and beauty as a noun means qualities such as shape, colour, sound in a person or thing that gives pleasure to the senses.

Both the Picasso and Bouguereau are important paintings and have aesthetic values. Whilst the Bouguereau may be said to give pleasure to the senses, the Picasso certainly doesn't.

IE, it follows that the aesthetic must be more than being concerned with beauty.

how does one go about identifying what counts as the aesthetic and what does not? — Tom Storm

There are numerous definitions of the aesthetic, from non-utilitarian pleasure to truth. Articles about aesthetics generally conflate aesthetic with beauty. As an aesthetic object can be ugly, the aesthetic and beauty are two different concepts. Therefore, looking at the Wikipedia article on aesthetics, for example, and removing any conflation between aesthetic and with beauty one is left with the following text:

It examines aesthetic values often expressed through judgments of taste
The word aesthetic is derived from the Greek, pertaining to sense perception.
In practice, aesthetic judgement refers to the sensory contemplation or appreciation of an object (not necessarily a work of art)
Judgments of aesthetic value rely on the ability to discriminate at a sensory level.
Aesthetic judgments may be linked to emotions or, like emotions, partially embodied in physical reactions
.It is said, for example, that "beauty is in the eye of the beholder".
It may be possible to reconcile these intuitions by affirming that it depends both on the objective features of the beautiful thing and the subjective response of the observer.
Classical conceptions emphasize the objective side of beauty by defining it in terms of the relation between the beautiful object as a whole and its parts: the parts should stand in the right proportion to each other and thus compose an integrated harmonious whole.
Aesthetic considerations such as symmetry and simplicity are used in areas of philosophy, such as ethics and theoretical physics and cosmology to define truth, outside of empirical considerations

Summarising the above - when observing a particular object in the world using the senses of sight, hearing, etc, and experiencing a particular subjective emotion or feeling brought on by a judgement that the parts of the object are combined in the right proportion to make a harmonious whole, then this is the aesthetic. In my terms, the aesthetic is a discovered unity within an observed variety.

Is all post-modern art free of aesthetic merit ? — Tom Storm

Postmodernism included art, beauty and aesthetics in their attack on contemporary society and culture. As yet, there is no unified postmodern aesthetic, but remain disparate agendas, as discussed in Hal Foster's The Anti-Aesthetic: Essays on Postmodern Culture.

As every object has a temperature, but not to the same degree, every object is an artwork, has beauty and has an aesthetic, but also not to the same degree. Even though Monet's Waterlily and a train timetable have an aesthetic, a Monet Waterlily has a greater aesthetic merit than a train timetable.

As the postmodernists have no agreed definition of the aesthetic, it is difficult to say whether or not postmodernism has an aesthetic of merit.

As regards my understanding of the modernist concept of the aesthetic - a discovered unity within an observed variety - postmodernism is free of modernist aesthetic merit, mainly because it has been a deliberate act on the part of the postmodernists to remove any modernist aesthetic.

Can you clarify how you would apply your modernist perspective to pre-modern era work? Say a Titian. — Tom Storm

Sentient life is thought to have started during the Cambrian Period, 541 mya to 485 mya and modern humans evolved from archaic humans 200,000 to 150,000 years ago.

It seems clear to me that the pre-1950 examples of art have features in common, and these features are different to the post 1950's examples. In fact, the pre 1950's examples could have been created by the same artist. As regards representation, pre 1950's is pictographic and post 1950's is symbolic. As regards aesthetic form, pre 1950's exhibit a distinct aesthetic quality whilst post 1950's minimise aesthetic quality.

The modernist style of the Modernist movement goes back to at least to the Lascaux cave paintings, painted by modern humans about 20,000 years ago. IE, the modernist style is not new, but is a feature of modern human art.

Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. — Pop

The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.

IE, how can consciousness interact with itself.

The aesthetic of art is what separates an airport novel from a Hemingway. Superficially,The Old Man and the Sea is a simple story of Santiago, an ageing experienced fisherman, but concealed beneath the words is a complex allegorical commentary on all his previous works. — RussellA

Thanks for your lengthy response. This is key I think to art discussions. Art (whatever it might be) is separate to craft or technical proficiency.

I studied aesthetics at university briefly (theory derived primarily from Monroe Beardsley) and it is clear that more bullshit is written about art than, even religion. My own interest is mainly the art from antiquity - I worked for a prestigious dealer in ancient Greek, Roman, Etruscan and Egyptian antiquities some decades ago and I remain haunted and tantalised by what I saw.

An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest. A work doesn't have to be good to be called art. This is the one thing people (often wilfully) overlook.

The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.
IE, how can consciousness interact with itself. — RussellA

This is what Enactivism tells us.
"Enactivism is a position in cognitive science that argues that cognition arises through a dynamic interaction between an acting organism and its environment.[1] It claims that the environment of an organism is brought about, or enacted, by the active exercise of that organism's sensorimotor processes. "The key point, then, is that the species brings forth and specifies its own domain of problems ...this domain does not exist "out there" in an environment that acts as a landing pad for organisms that somehow drop or parachute into the world. Instead, living beings and their environments stand in relation to each other through mutual specification or codetermination". - Wikipedia

What information is , is a huge and contended topic in itself. I have understood it as an interaction, consistent with enactivism, and systems theory.

Sketched roughly and simply: Information causes a change in neural state. When we look in any direction, we see a picture already coloured in and symbolized subconsciously, whilst science tells us that no colour exists in the external world. We then interact with this symbolized picture. In cognitive science, a Markov blanket presents us with this initial perception, and then other similar processes act on this in a sequential fashion to eventually arrive at some resolution . This reveals how it is then quite easy to insert imagined or memorized input into the process rather than external sense derived information, and how consciousness is the result of this information processing and integrating. In short it makes no sense to think of an organism absent of it's environment, and likewise it makes no sense to think of art absent of the artist, or as you point out, the observer. We need that interaction for information to occur, and in the process of integrating that information consciousness occurs, and clarity about what is going on emerges, and action results, etc. The information flows in this way, as I envision it, due to interactions, and the result is that everything is enmeshed, codependent, codetermined, and coevolving, on absolutely all scales.

(y)

An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest. — Tom Storm

In short it makes no sense to think of an organism absent of it's environment — Pop

(y) Totally agree.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42)

This approach also seems similar to evolutionary aesthetics and ethics, where the basic aesthetic and ethical preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. A topic initiated by Charles Darwin's The Descent of Man and developed by Herbert Spencer.

Enactivism and the analogy of the sand dune
A particle of sand is subject to forces from other sand particles and the wind, meaning that the dynamic interaction between the sand particles and wind brings about the formation of sand dunes. The sand dune evolves because of an dynamic interaction between the particles of sand and their windy environment. The sand dune cannot be understood absent from its environment. The movement of any particular particle of sand is determined by the forces acting on it from surrounding particles of sand and the wind, a deterministic cause and effect. The particles are organised into sand dunes by the physical nature of each particle and the wind acting on them.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment.

Information about a thing is an extrinsic property of the thing
The evolution of a sand dune is driven by a complex set of wind forces on a complex set of particles of sand. A single mass may be expressed in terms of information, weight, location, etc. A single force can be expressed in terms of information, direction, strength etc, but such information is an extrinsic property of the force rather than an intrinsic property. Therefore, any effect of the force is not determined by any information that can be expressed of the force. Therefore, the evolution of the sand dune is determined by the forces and particles of sand, not by any information that may be expressed of the forces or of the particles of sand.

IE, evolution cannot be driven by information

I'd say art is the objective absense of waste. All other waste, present or absent, is subjective.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment. — RussellA

:up: Yes, that is a good way of putting it. @Gnomon illustrates something similar here.

evolution cannot be driven by information — RussellA

It depends on what you understand information to be. Incredibly in this "information age" we do not have a universally agreed upon definition of information. :grimace: I have understood information to be equal to interaction. In the sand dune analogy, all those gazillions of interactions that eventually self organize to a sand dune are information. Ie: information is identical to interaction, and can be thought of as evolutionary interaction. This might explain it better, and this.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42) — RussellA

Kantian idealism would probably agree with the understanding that everything is information, although he couldn't have been aware of the neural correlates of perception in his time, so would have probably understood information as something changing an immaterial mind. If we accept neuroplasticity and the idea that perception entails a physical change in brain state, then all information can be understood in a universally applicable and regular way - as a change causing physical interaction. This message is not something you can passively just receive - initially it changes your brain state, which causes further neural interaction, until the process resolves to some clarity.

To illustrate just briefly: My physical brain state, causes a change to the physical keyboard state, which causes a change to the computer hardware state, which causes a change to various internet routers, which cause a change to your device, which causes a change to your brain state. So information is a "change causing interaction universally", in my understanding.

It depends on what you understand information to be — Pop

Although slightly digressing, the following is relevant to "The Definition of Art".

As @Mark Nyquist noted, something that may be overlooked is the definition of the word definition.

On the one hand @Banno wrote "definitions are not all that helpful", but on the other hand
writes about InPhO that "the potential is extraordinary". Yet InPhO is founded on the definition. Barry Smith in the video How to Build an Ontology says that the three steps are 1) you create an ontology which in the simplest possible terms is a controlled vocabulary of labels, 2) you provide logical definitions for those labels so that you can compute using the labels and 3) and then you tag the data using those terms typically you tag the data with URI's addresses

Without definitions, communication would be impossible. If I asked someone to pass me the salt, and they did not know the meaning of salt, rather than tell them to read Salt: A World History by Mark Kurlansky, a more useful approach would be to say that salt is a white crystalline substance that gives seawater its characteristic taste and is used for seasoning or preserving food.

It is true as you say that "It depends on what you understand information to be", in that sometimes the same word can mean different things to different people, but without the "principle of charity" communication would become impossible.

Perhaps the reader should treat the writer's words and phrases more like idiomatic expressions than literal descriptions. Often a phrase has a meaning independent of the words used, as "in my job interview I had to jump through hoops", where neither jumping nor hoops were involved.

I fully accept the concept behind Kant's "synthetic a priori", though disagree with the word synthetic being used in combination with the word a priori, in that I have decided to treat synthetic a priori more as an idiomatic expression that a literal description. Similarly with "I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions I fully agree with them, even if I may have a different opinion as to the particular choice of words, ie, information and self organisation.

"I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions — RussellA

:up: Yes, these expressions are idiomatic to my evolving understanding of information and consciousness. They are based on established theory, but my personal interpretation of it. You have agreed with more than I would normally hope for, so I am pleased overall.

As you say, in communication, some degree of charity is necessary, and given some charity I think the definition would normally pass. However I wouldn't normally expect charity in regard to a "definition" of art, so I had to test the definition by developing a deeper understanding of both consciousness and information. Both neglected and contented concepts in western thought. It turns out they are related concepts, in that consciousness at any moment is a state of integrated information, that exists as an evolving process, for the purpose of self organization. Again this is not a universal understanding, but idiomatic to my personal understanding of Systems Theory, Constructivism, Enactivism, IIT, and aspects of Yogic logic, and the emergent understanding that information is fundamental - which will, imo, challenge a lot of established understanding about information, amongst many other things.

emergent understanding — Pop

As you mentioned consciousness and emergence, I wonder if the sand dune analogy gives any insights.

If the observer is aware of the particles of sand, force of the wind on them and the resultant form of the sand dunes, they would explain the shape of the sand dunes as an example of "weak emergence". But, if the observer was only aware of the particles of sand and the resultant form of the sand dunes, they would explain the resultant shape of the sand dunes as an example of "strong emergence".

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness.

In practice, we observe a strong emergence of the mind/consciousness from the neurons of the brain. Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism.

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness. — RussellA

Yes, that is how I would describe it also. The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. Absolutely everything can be described in the same terms, as form resulting from historical interactions. If we understand these interactions as information ( where information is an inForming ), then everything can be described as an evolving informational body, where the latest form of said body is it's integrated information, and integrated information is equal to consciousness. Obviously our consciousness is far more complex and far more advanced then a sand dune so far more conscious, but it results from the same informational / interactional process.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism. — RussellA

The quantum foam lacks form, as it is random and probabilistic, however once a wavicle integrates it's information with another wavicle, then the informing process begins and can continue to amass to elementary particles, atoms, molecules, and so on. The pattern of the physical arrangement of the atoms
gives rise to different materials, or forms. In the end all these different forms emerge, but from the same process.

Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence. — RussellA

:up: Yes, or put another way - it is a self organizing universe, but what is the source of self organization?

I know what you mean, and I don't want to unnecessarily quibble about words, but the choice of word does have an effect.

but what is the source of self organization? — Pop

Yes, where is Force X ?
The problem of strong emergence would be reduced to that of weak emergence if we could discover the missing force acting on the neurons.

If we understand these interactions as information — Pop

In snooker, a cue ball hits a coloured ball at rest. I can describe the system before the interaction by knowing information about the position of interaction, initial cue ball speed and direction. I can describe the system after the interaction by knowing the information about the final cue ball speed and direction, coloured ball speed and direction.

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ?

The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. — Pop

Organising
1) I can organise books on a shelf - the books don't self organise.
2) A computer can organise numbers into increasing size - the numbers don't self-organise.

1) The snooker cue doesn't organise the final resting position of the snooker balls - the final resting position is a consequence of deterministic cause and effect.
2) The wind doesn't organise the final form of the particles of sand - the final form of the sand dune is a consequence of deterministic cause and effect.
3) Force X doesn't organise the final form of the neurons - the final form of consciousness is a consequence of deterministic cause and effect.

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect

Self-organising
At the start of a game of snooker, a snooker cue hits a cue ball which hits a coloured ball, and eventually the snooker balls come to rest.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ?

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ? — RussellA

Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness.

1. Potential information exists in the book on a shelf

2. Actual information occurs when we read it - interact with it.

3. Consciousness occurs when this interaction is integrated with past informational structure - ( knowledge in constructivist fashion ).

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect — RussellA

Books on a shelf, etc, are an expression of your self organization, rather then the book's self organization. Leave the book in the weather for a time and then it will "self" organize. The organization I am referring to is intrinsic self organization. Everything exists as an evolving process of self organization, so changes over time, due to interactions, including rocks. Nothing stays still and permanent, in the absolute sense.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ? — RussellA

Yes in all these cases self organization has occurred. And you would be asking - if this is the case than who or what does the thinking? It is something I wonder about also. :grin: In my understanding, Information is self organizing, and thus self integrating. Interactions self organize to an integrated form, and all that exists, exists as an artefact of this process. The symbolic self is an artefact of evolutionary neuroplasticity.

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X — RussellA

Yes, the source of self organization is what does the thinking. Is it the anthropic principle - the combined laws of the universe causing everything to self organize? Is it god? This is where the philosophy gets interesting. Once you decide on the source of self organization, you close off other possibilities and commit yourself to a theory of everything which forms your reality.

In Yogic logic ( my interpretation ) the source of self organization is consciousness. This is a wise move, where consciousness is left as something undefined and fundamental - where everything and everybody is, at heart, made of the same stuff, just different in Formation :grin: Reality here has infinite potential, it can continue to evolve beyond what can currently be conceived, and the self organizing information theoretic remains logically coherent.

Sentient life is estimated to have evolved on Earth during the Cambrian period about 541 mya to 485 mya. The start of the Universe is estimated at about 13.8 billion years ago. Before sentient life evolved on Earth, physical objects changed with time - lava flowed down the sides of volcanos, rocks bounced down the sides of mountains, etc.

Is it valid to say that the interaction itself is information ?........Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness — Pop

Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ?

Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ? — RussellA

Basically yes, but we have to bear in mind we have conceptualized consciousness to a state of integrated information. What you describe is a situation where that state is disturbed, and then reintegrated again. Fritjof Capra states "cognition is a disturbance in a state", and everything is a system in a state, according to systems theory. However there is a world of difference between the interaction of two molecules, and the interactions of 24 million molecules making up an average human cell, and then 30 odd trillion of such cells making up human consciousness. So we are talking about very different results indeed, however they are the same in terms of information having been disturbed and reintegrated.

In systems theory we can take any part of the universe, such as the biosphere and know that it is made up of self organizing interacting subsystems all the way down to plank length and perhaps beyond. For things such as rocks, they require a physical interaction for their total information to change, for sensing organisms however this physical change of state can occur due to a perception of a change in their environment.

at the moment of interaction the wave function collapses giving rise to consciousness ?................Basically yes — Pop

Koch wrote "By postulating that consciousness is a fundamental feature of the universe, rather than emerging out of simpler elements, integrated information theory is an elaborate version of panpsychism"

Meaning of "integrated"
On observing a system, such as "an apple on the table" my consciousness about "an apple on the table" is integrated. IE, in that a conscious experience is unified and irreducible, in that seeing a blue book is not reducible to seeing a book without the colour blue, plus the colour blue without the book.

Meaning of "information"
Consciousness is specific. Each experience is composed of a specific set of phenomenal distinctions, a blue colour as opposed to no blue colour, no bird as opposed to a bird.

My consciousness is expressed by my "neural state"

a) On observing a system, for example, "an apple on the table", I am conscious of the information contained within the state "an apple on the table".
b) Suppose the system changes
c) On observing the new system, "no apple on the table", I am conscious of the new information contained within the state "no apple on the table".

In @Pop's terms:
1) "information causes a change in neural state"
2) "information is not something static, but something dynamic"
3) "information is the interaction of physical form"

In my terms:
1) The change in information causes a change in neural state.
2) Information is static, a change in information is dynamic.
3) As regards "information", the observer of the system is conscious of information about the system. As regards "interact", the physical form of the observed system interacts with the physical form of the brain's neural state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

The problem of information as fundamental
Taken from John Searle's criticism of Tononi and Koch explanation of Integrated Information Theory

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. Either the information is carried by a conscious experience of some agent (my thought that Obama is president, for example) or in a non-conscious system the information is observer-relative - a conscious agent attributes information to some non-conscious system (as I attribute information to my computer, for example)"

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder"

Art, aesthetics and information
The observer may have information about a piece of art - painted by Andre Derain, dated 1905, titled The Drying Sails, sized 82 × 101 cm.
The observer must be conscious of the artwork in order to know information about it.
The observer has a subjective aesthetic experience when an artwork having a particular physical form interacts with a particular neural brain state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder".

That is an excellent post :smile: It is such a pleasure to find intelligent and probing conversation.

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. — RussellA

If this were true then we couldn't use information to explain anything, as everything is relative to a consciousness. IE: it is not art that we speak of but our consciousness of art - perhaps a concept that exists slightly differently in our respective minds, as per all concepts. So it is important to have definitions that we agree on, and to be able to pose concepts in the third person perspective ( in the empirical objective tradition), such that we can engage with the concept purely intellectually, and then incorporate it, or not, into our personal perspective.

We can pose a concept of how information works in the empirical tradition and then decide on whether this makes sense or not.

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder" — RussellA

Much of this speculation exists outside of a definition of information. If information is understood as evolutionary interaction, then the interactions that led to the forming of a photo diode could be understood as a creation of an informational body in a certain form, that interacts with other informational bodies of certain form, and they change each others form in the process of information / interaction. Posed this way we avoid the difficulties of understanding what another informational body in a certain form experiences. Which we cannot know for certain, but if elementary particles are formed due to forces acting on them, then surely they would be feeling those forces? They may not be able to feel those forces in a self aware sense as we do, but there are forces acting on them and they conform to those forces, as we do. Evidently some of those elementary particles eventually form amino acid molecules that self organize to life. Imo, this is deterministic with a slight element of randomness - it is consistent with the accumulative informational body theoretic - that informational bodies can continue to evolve in complexity.

Systems and complexity theory are near enough to a theory of everything.
In Systems Theory; everything = interaction
For a person: everything = information
Therefore interaction = information, where a person is a complex adaptive system.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder". — RussellA

I would say the beholder is a body of integrated information, and the latest state of this is consciousness, and if the latest information integrated is purely visual or auditory, and results in a pleasant feeling, then the chances are that we have witnessed or heard something beautiful. So yes beauty is in the eye of the beholder, but information is something different. If we understand information to be interaction, then information is the change causing interaction between an externality and the integrated body of information - a body that exists entirely as a result of past such interactions, from the biological, experiential, and relative perspectives.

In one respect it does not make sense to say a body exists as a state of integrated information as it is always interacting, changing, and evolving, but in order to deal with it, we need to conceptualize it at some level, and so I conceptualize it to moments of consciousness, that exist as states of integrated information, as per IIT. And then, in those moments of consciousness the information is resolved to some clarity, entirely from the perspective of the integrated information, or as you say the eye of the beholder.

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from.

it is not art that we speak of but our consciousness of art — Pop

(y) Agree, of the three main epistemological approaches, Idealism, Indirect Realism and Direct Realism, I tend to Indirect Realism. In Indirect Realism, the external world exists independently of the mind, and we perceive the external world indirectly, via sense data. Our subjective experience is private, and even if the object remains the same, our subjective experience may change.

it is important to have definitions that we agree on — Pop

(y) Yes. It has been said that "definitions are not all that helpful". Accepting that language with definitions is difficult, language without definitions would be unworkable

If information is understood as evolutionary interaction — Pop

(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information"

deterministic with a slight element of randomness — Pop

(n) A deterministic system cannot be random, unless one brings in free-will

Therefore interaction = information — Pop

(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction.

yes beauty is in the eye of the beholder — Pop

(y) Until the eighteenth century, most philosophical accounts of beauty treated it as an objective quality. Augustine in De Veritate Religione asks explicitly whether things are beautiful because they give delight, or whether they give delight because they are beautiful. He emphatically opts for the second.

Even on the Forum, some still argue that "The observer only uses the act of perception over beauty, but the beauty is still there, regardless of the observer"

Though I'm with Kant, who wrote in The Critique of Judgement -
"The judgment of taste is therefore not a judgment of cognition, and is consequently not logical but aesthetical, by which we understand that whose determining ground can be no other than subjective. Every reference of representations, even that of sensations, may be objective (and then it signifies the real [element] of an empirical representation), save only the reference to the feeling of pleasure and pain, by which nothing in the object is signified, but through which there is a feeling in the subject as it is affected by the representation".

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from. — Pop

The link between what the system experiences and what the system interacts with
David Hume in Moral and Political 1742 wrote "Beauty in things exists merely in the mind which contemplates them.". Is beauty in the thing independent of the observer, or as Hume wrote, in the mind of the observer ?

My strong belief is that there is a direct informative analogy between the observation of an object such as Window at Tangiers by Matisse and a resulting subjective aesthetic experience, and the ability of an opera singer to use their voice alone to shatter a wine glass.

https://www.youtube.com/watch?v=Oc27GxSD_bI

The wine glass shatters. Is it the pitch of the voice that causes the glass to shatter, or is it the shape of the glass that cause the glass to shatter ? It is in fact neither alone, but a resonance between the two, an interaction between the two. In order for the glass to shatter, the voice has to be of one particular pitch and the glass has to be of one particular shape. Resonance is an example of a deterministic cause and effect.

The experience of art requires both a particular artwork and a particular observer, not an artwork alone in the absence of an observer, and not an observer alone in the absence of an artwork. So where is beauty. Beauty cannot exist in an object in the absence of an observer, and beauty cannot exist in an observer in the absence of an artwork. Beauty is a "resonance" between the observer and the artwork.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world. — RussellA

This seems very prescriptive. May I clarify? Does this mean if I walk up to Rembrandt's Night Watch and have an experience no different to looking at a lunch box lid, the paining does not count as art? And does this mean that art can be any object which causes a mind to resonate aesthetically?

(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information" — RussellA

We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with. whether they be memory, imagination, or sense generated. When exactly consciousness emerges in those moments is hard to say, is it instantaneous, does it slowly resolve during the course of a moment, or crystalize at the end of a moment? I don't know, but I would say during those moments there is a multiplicity of interactions occurring, and they resolve to a singular picture somehow, that we know as consciousness - at that moment the information / interaction has been resolved. As you say, understanding information is important to this, and there is no singular, universally agreed upon, definition.

A deterministic system cannot be random, unless one brings in free-will — RussellA

Landauer's principle
It holds that "any logically irreversible manipulation of information, such as the erasure of a bit or the merging of two computation paths, must be accompanied by a corresponding entropy increase in non-information-bearing degrees of freedom of the information-processing apparatus or its environment". - Wiki.
This is something that may be relevant to consciousness. In the process of information, as an interaction of one part to another, there is an element of entropy which changes the deterministic nature of the relation, such that a tiny degree of randomness arises - perhaps this is what causes emergence?
Could Landauer's principle explain it?

Perhaps this is free will? :smile:

(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction. — RussellA

In my understanding, how the snooker balls exist outside of a moment of consciousness and thus an interaction with them, is probabilistic, no matter how certain we may be, as per Schrodinger's cat situation.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world. — RussellA

:up: So an interaction ( resonance )? Sounds like Enactivism to me?