That would seem to me to make the mind the "internal world." — Ciceronianus

:100:

I believe we both acknowledge that we exist in the world, as do other living organisms and things. You clearly think that those other creatures and things are "external" to us. If by that you mean they exist in the world along with us, in addition to us, I agree. If you mean they exist in a world that is outside us, I don't agree. — Ciceronianus

I agree that in this world that we live in, other living organisms and things are external to us.

I too don't believe in a multiverse, where other living organisms and things external to us live in a world outside the world we live in.

Words have meanings, and as regards the phrase "external world" in the context of a discussion about the philosophy of the mind, external means external to the mind and world means the world we live in, not another world outside our world in the multiverse.

It is of course OK for you to give words meanings that are not commonly accepted within the context that they are being used in, but it does cause confusion.

Direct Realism is a philosophy of the mind based on the theory of perception that claims that the senses provide us with direct awareness of the external world.

Philosophers often use “Naïve Realism” as a synonym for “Direct Realism”, though sometimes Naive Realism is taken as a strong form of Direct Realism, more along the lines of Aristotle's approach.

In the context of the philosophy of the mind, the phrase "External World" is the view that in the world there are things or events that exist independently of the mind.

I don't think our minds are separate from the world; I think they're parts of the world just as we are — Ciceronianus

If the mind is part of the world, then in the world there is the mind and there is that which is outside the mind, ie, an "external world" - ie leading to the possibility of Naive Realism, Direct Realism or Indirect Realism.

So, the question "Is there an external world which exists independently of the mind?" seems to me to be...well, weird. — Ciceronianus

This would mean that there is no "external world" - ie, Idealism


These two viewpoints seem contradictory.

The phrase "external world" has an accepted meaning, and it is about things or events that exist independently of the mind.

1) For the Psychology Dictionary, the world of real and existing things external to and independent of our consciousness.
2) For Wiktionary, the world consisting of all the objects and events which are experienceable or whose existence is accepted by the human mind, but which exist independently of the mind.
3) For GE Moore Proof of an External World, the category of “external things” is the category of space-occupying things that may fail ever to be perceived.
4) For Putnam, “If we can consider whether [the hypothesis that we are brains in vats being electrochemically stimulated to have the very experiences that we’ve had] is true or false, then it is not true… Hence it is not true”
5) For Davidson and McDowell, agreement that experiences justify beliefs about the external world only if experiences have contents that can be assessed for truth.

It is definitely not about the concept expressed in the statement - "The world" cannot be "external" to – ontologically separate from – itself, which includes its constituents (Spinoza)

Given agreement as to the meaning of the phrase "external world", then the topic "there's no "external world" can be discussed.

For me, there's no "external world." — Ciceronianus

Here's what I'm proposing, regardless of whether it comports with anyone's idea of naive realism or direct realism. — Ciceronianus

Are you saying there must be an "external world" unless the universe feels pain (for example)? — Ciceronianus

Your question leads to a paradox. If the "external world" must exist, then it must exist whether or not it feels pain. But if it feels pain, then it cannot exist. But it must exist..............

Definitions
A common definition of "external world" is "the world consisting of all the objects and events which are experienceable or whose existence is accepted by the human mind, but which exist independently of the mind".
A common definition of "Direct Realism" is that the external world exists independently of the mind (hence, realism), and we perceive the external world directly (hence, direct).

The world and pain
I believe that humans, and sentient beings in general, feel pain. My belief is that pain does not exist in the world external to sentient beings.

I am not saying there must be an "external world", as my knowledge about the world is insufficient for me to know that, but I am saying that I believe that there is an "external world".

I am also not saying that the world external to sentient beings cannot feel pain, as again my my knowledge about the world is insufficient for me to know that, but I am saying that I believe that the world external to sentient beings doesn't feel pain.

IE, I am not saying that "there must be an "external world" unless the universe feels pain", I am saying that "I believe that there is a world external to sentient beings, and I believe that this world external to sentient beings doesn't feel pain"

Summary
One aspect of Direct Realism is that the external world exists independently of the mind. As you propose that there is no "external world", am I correct in thinking that your view is neither Naive Realism nor Direct Realism, but something else, such as Idealism, as @Hanover suggests ?

For me, there's no "external world." There's a world of which we're a part. There isn't one world for us and another world for everything else. — Ciceronianus

I think they're attributes of human beings, and so are part of the world in that sense, but don't know that it follows that they're attributes of the universe. — Ciceronianus

I was misled by your use of the phrase "external world"

There must be an "external world" if pain, love, colour, consciousness, etc are attributes of human beings, yet not attributes of the universe.

Though I agree with the idea that just because a human has the attribute of perceiving the colour red, it doesn't follow that the colour red is also an attribute of the "external world"

For me, there's no "external world." — Ciceronianus

Direct Realism and Panpsychism

I agree that the human is part of the world, and has evolved as part of the world over hundreds of millions of years. However, the world can still be divided into humans and that which is external to humans.

Humans have what Chalmers calls "qualia" and others call subjective experiences, such as pain, love, colour, consciousness, etc.

If there is no "external world", then human experiences are just part of the world's experiences. IE, all the attributes of the mind - pain, love, colour, consciousness, etc - are also attributes of the world. As consciousness is a human experience, then consciousness must also be an experience of the world.

Panpsychism is the view that the mind is a fundamental and ubiquitous feature of reality. It seems that it necessarily follows that one of the consequences of Direct Realism is a belief in panpsychism.

I'd say we're responsible for the insertion (for science as well, in fact). If we're part of the same world, there is no insertion of anything. There's nothing (no thing) between us and the rest of the world that is the "red" of which we speak. This purported "thing" is something we dreamt up, I think. — Ciceronianus

A letter box emits a wavelength of 700nm. When looking at the letter box we perceive the colour red.

Direct Realism claims that when we do perceive something, the immediate and direct object of perception is the external world, not the mind.

I cannot understand how the immediate and direct object of perception (the colour red) is the external world (the wavelength of 700nm).

How does the Direct Realist justify that the colour red exists independently of any observer in the wavelength of 700nm ?

"Naive realism" (a/k/a direct realism) is the view that those things we deal with every day, indeed every instant, taken for granted by all but philosophers and their students (so it may seem), are perceived by us immediately or directly. — Ciceronianus

Consider our perception of the colour red. The cause of our perception is not the colour red but a wavelength of 700nm. As it is commonly agreed that that humans when observing a wavelength of 700nm consistently perceive the colour red, it is therefore not unreasonable to say that our perception of the world is valid and presents no concern. However, it does not necessarily follow from this that what we perceive, the colour red, is being caused by the colour red. In fact, it is being caused by a wavelength of 700nm.

This question refers back to the debate about Kant's thing-in-itself. In the dual object view, the thing-in-itself is an entity distinct from the phenomena to which it gives rise. In the dual aspect view, the thing-in-itself and the thing-as-it-appears are two "sides" of the same thing. As the perception of the colour red is a distinct entity from what caused the perception, a wavelength of 700nm, it seems reasonable to say that the dual object view is the more reasonable.

Science shows us that our perception of red has been caused by a wavelength of 700nm, so it is science that has "inserted" something between our perception and the external world, a science with its roots in Ancient Egypt and Mesopotamia around 3000 to 1200 BCE.

One could conclude that, taking this example of our perception of the colour red, Direct Realism does not explain how we perceive the world.

However, the fact that Direct Realism is not the explanation does not mean that our senses don't function quite well, it does not mean that we are detached from the world and it does not mean that our interaction with the world is not immediate.

As regards the "veracity of our senses", our senses accurately translate a wavelength of 700nm into a perception of the colour red, and as regards "perceived by us .......directly", there is a direct correspondence between our perception of the colour red and the wavelength of 700nm.

IE, Direct Realism would mean that our perception of the colour red has been caused by a colour red, but science has shown us that this is not the case. A better term would be Indirect Realism, allowing for the fact that our perception of the colour red has been caused by the wavelength of 700nm.

There are nineteen uses of the concept “noumenon” or its derivatives in CPR. None of them equate noumena with the ding an sich. — Mww

I didn't know of the debate about how a noumenon relates to a "thing-in-itself". More reading to do.

A relevant paragraph in Critique of Pure Reason is:
"The concept of a noumenon, i.e., a thing which is not at all to be thought as an object of the senses, but rather only as a thing on its own (solely through a pure understanding), is not at all contradictory, for we still cannot assert of the sensitivity that it be the single, possible manner of perspective."

Rather than writing "In Kantian philosophy, a noumenon is a thing as it is in itself.", perhaps I should have written "In Kantian philosophy, a noumenon is a thing on its own".

we don't simply imagine the things in the world in any way analogous to how we imagine the things of our literary fictions. — Janus

I am trying to be careful in distinguishing complex objects, such as "unicorns", "tables" or "multiverses" from simple empirical experiences through our five senses, such as a screeching noise, the colour red, a sweet taste, an acrid smell, the pain of a needle.

This is why I previously wrote: "My belief, along the lines of Kant's phenomenon and noumenon, is that all understanding we have of complex objects in the world is fictive, whether "unicorns", "tables" or "multiverses""

I believe that our understanding of complex objects, such as a table, is as fictional as our understanding of Sherlock Holmes, but this does not include our experience of simple sensations, such as the pain of a needle, through the five senses.

You keep going back and forth between calling everything in our experience and imagination fictional (thus rendering the claim vacuous) — SophistiCat

Not quite.

Taking a table as a particular example of "everything in our experience". Our understanding of what a table is may be fictional, without rejecting the idea that there are facts in the world which we think of as a table. The word "fictional" retains meaning, as fictions in the mind are set against facts in the world.

You keep going back and forth between calling everything in our experience and imagination fictional (thus rendering the claim vacuous) or specifically those things that we cannot empirically verify (thus merely misusing the word 'fictional'). — SophistiCat

Not quite.

Our concept of complex objects, such as a table, is a fictional interpretation of facts in the world. Our knowledge of facts in the world derives from empirical observation of the world discovered through our five senses, such as a screeching noise, the colour red, a sweet taste, an acrid smell, the pain of a needle. Our imagination assembles these parts into a whole. Each part, a particular sensation through one of our five senses, directly comes from a fact in the world through empirical observation. The whole, our concept of a table, is a fictional assembly of mereological relations between these parts.

you refer to as 'noumenon' is real according to the first criterion (as opposed to the 'phenomenon') and fictive according to the second. — SophistiCat

Kant did not argue that the world of the noumenon does not exist, for there to be an appearance, there must be something for there to be an appearance of. In Kantian philosophy, a noumenon is a thing as it is in itself, as distinct from a thing as it is knowable by the senses through phenomenal attributes.

There are things in the world, and as facts in the world they are real. But, our understanding of complex objects, such as tables, which are assemblies of things in the world, is fictive.

First, most people on the forum here don't accept personal experience as evidence. A good example is reported personal experience of God. Based on that, there is no evidence at all for qualia, so, yes, it is a metaphysical property or meaningless. No, I don't believe that — T Clark

Your previous statement was "There is strong evidence that I experience the color red. When you hold up a card colored red, ask me what color it is, and then I say red. When my brain lights up in a red way on the MRI. That's all evidence."

Your new statement seems contradictory to your previous statement.

Your new statement seems to say that there cannot be evidence for what may be called "qualia".
Your previous statement seems to say that there can be evidence for what may be called "qualia"

Previously you used the term 'fictional', which means imagined, now you have changed to 'fictive' which has different, although related, connotations, for me at least. (Perhaps I should look them up in the fictionary) — Janus

To save you having to look words up in the dictionary, both fictive and fictional are adjectives describing literary ideas created by the imagination, ideas that are unreal or untrue.

However, fictive is more creative, or more imaginative, than fictional, as in the fictive world of Blade Runner and the fictional world of Around the World in Eighty Days.

There is strong evidence that I experience the color red. When you hold up a card colored red, ask me what color it is, and then I say red. When my brain lights up in a red way on the MRI. That's all evidence — T Clark

The MRI scanner can make measurements of your brain when you look at the colour red, but can the MRI scanner determine that you are experiencing what Chalmers calls the "qualia" of the colour red and others call the subjective experience of the colour red ?

you singled out multiverses in particular as fictional — SophistiCat

Far be it for me to say that the multiverse doesn't exist.

If we can never know whether the multiverse exists or not, even in principle, then we can only know the multiverse as a fictional entity, even if the multiverse does exist as a true fact.

I started this thread to discuss things like the multiverse and my belief that, if I can't know, demonstrate, whether or not it exists, it's existence has no truth value or is meaningless. — T Clark

I know that I have the subjective experience of colours. I believe that you also have the subjective experience of colours.

I can never know that you have, and I can never demonstrate that you have, but for me, the possibility that you have a subjective experience of colours has both a truth value and meaning.

The truth value is that the proposition "T Clark has the subjective experience of colours" is either true or false.

As regards meaning, the fact that you can or can not have the subjective experience of colours has meaning to both you and me.

IE, unprovable beliefs have both a truth value and meaning.

multiverses........You say they are fictional, but we don't know that, because that would be to know that they don't exist. — Janus

My belief, along the lines of Kant's phenomenon and noumenon, is that all understanding we have of complex objects in the world is fictive, whether "unicorns", "tables" or "multiverses".

However, even if our understanding of complex objects in the world is fictive, this is independent of the question as to whether such complex objects as unicorns, tables and multiverses actually exist as facts in the world.

my question is as to whether we can even sensibly speak of the multiverse in terms of being actual or not actual. Intuitively, of course, it seems we can; but if that's right then we do think that untestable conjectures can be true or false. — Janus

How can we talk about "multiverses" when multiverses are unknowable ?

It is the same problem that goes back to Kant's phenomenon and noumenon. Kant proposed that a phenomenon is a perceptive representation of an object existing in the mind of a perceiver, rather than the object in itself, the noumenon. Kant did not argue that the world of the noumenon does not exist, for there to be an appearance, there must be something for there to be an appearance of. It is just that human knowledge of the true nature of the noumenon is impossible, as the true nature of the noumenon is always mediated by the senses. In that, for example, we perceive the colour red, we don't perceive a wavelength of 700nm.

In this sense, all our beliefs are fictional, and every proposition we use is about a fictional object. When we ask, is the proposition "the multiverse exists" true or false, we are not referring to an unknowable entity in the world, but we are referring to a fictional entity "the multiverse". Similarly, when we ask, is the proposition "there is a table in front of me" true or false, whilst it is true that the parts that make up the table exist in the world and are knowable through the senses, the "table" as a whole, as a particular set of parts, only exists in the mind of the observer.

Therefore, complex objects such as "unicorns", "tables", "chairs", "mountains" and " multiverses" only exist in the mind in the imagination, and are therefore fictional. However, the fact that our all our beliefs are about fictional objects makes no pragmatic difference to our ability to exist within the world.

If I want a beer in a Tanzanian bar, all I need to know is to speak the symbol "bia moja tafadhali". I need know no more. I don't need to know the process of what happens between my speaking the symbol and my achieving my goal. The symbol "bia moja tafadhali" has no meaning in itself outside of any context it is used in. My speaking the symbol "bia moja tafadhali" in the context of a Tanzanian bar means that I will be given a beer. The symbol only has meaning within the imagination of the users, and is therefore fictive.

I may believe that "unicorns exist" is a fiction, but I don't know that unicorns don't exist. I may believe that "the multiverse exists" is a fact, but I don't know that multiverses do exist.

Even if unicorns, tables and multiverses must always remain unknowable, "unicorns", "tables" and "multiverses" can be knowable as fictive entities within the observer's imagination.

IE, in answer to your question, we can sensibly speak of the "multiverse", as what we are speaking of is a linguistic fiction, whether or not it is a fact in the world, and as a linguistic fiction can be either true or false.

1) Can a statement be true or false if it is not possible to determine which it is, even in principle? Then, if we can decide that question, 2) What happens if we can't determine if the truth of a statement is decidable in principle or not? — T Clark

If it is not possible to determine even in principle whether the proposition "a multiverse exists" is true/false, then the first problem is not whether the proposition "a multiverse exists" is true or false, but what does "multiverse" mean.

We have the concept multiverse, but if we can never know even in principle whether multiverses exist or not, our concept of multiverse must remain fictional, as a unicorn or Conan Doyle.

IE, if we can never determine even in principle whether the proposition "a multiverse exists" is true or false, then the "multiverse" must remain a fictional entity, as a unicorn or Conan Doyle.

@Janus I can't decide whether the question as to whether propositions that are undecidable for us can nonetheless be true or false is itself undecidable or not"

Starting with @T Clark's question "Can a statement be true or false if it is not possible to determine which it is, even in principle?"
Considering "there is a god beyond our comprehension" as an example of a proposition which we can never know even in principle whether true or false.
So, the answer to @T Clark's question is yes, a proposition such as "there is a god beyond our comprehension" not only can be true or false but must be either true or false.

In answer to @SophistiCat's question as to where does this lead, it leads to the knowledge that there are some things that are beyond our comprehension.

Question 1) Can a statement be true or false if it is not possible to determine which it is, even in principle?
Statement 1) Since there is no evidence whether it is possible to determine the truth or falseness of the multiverse interpretation of QM, should that interpretation be given serious consideration as a scientific theory? — T Clark

There may be no evidence today determining the truth or falseness of the multiverse interpretation of QM, but there may be evidence next year. As @Philosophim wrote: "Maybe humanity will discover the truth about multiverse theory, and maybe they won't"

Question 1) refers to a proposition that it is not possible even in principle to determine whether true or false.

As it may be possible to determine whether the proposition "there is a multiverse" is true or false, it is therefore possible in principle to determine that the proposition "there is a multiverse" is true or false.

Therefore, question 1) has no bearing on statement 1).

(Although I am not sure everyone would agree that there is no evidence for a multiverse)

those things within an art work that draw us in and with which we make an emotional connection. — TheVeryIdea

On seeing Munch's Scream, the screaming face has an immediate emotional meaning.

But the screaming face also has a symbolic meaning, a symbol of of despair, which, when one reflects on it, may result in the remembrance of an emotion of despair.

The question is, when I look at The Scream, am I looking at an analogical representation having immediate emotional meaning or a symbolic representation having a cerebral symbolic meaning which may subsequently result in an emotional meaning.

one might expect everyone to have similar preferences — TheVeryIdea

Wikipedia Novelty Seeking writes - "In psychology, novelty seeking (NS) is a personality trait associated with exploratory activity in response to novel stimulation, impulsive decision making, extravagance in approach to reward cues, quick loss of temper, and avoidance of frustration. Although the exact causes for novelty seeking behaviours is unknown, there may be a link to genetics". This novelty gene is thought to appear in a portion of the human population, something that may explain the differences in our temperaments.

IE, as the worlds of art are fueled by a thirst for novelty, novel creations also carry their own aesthetic merit.

However other more complex symbology, which is often seen as operating at a higher level, is more intellectual and less evolutionary, less base-instinct and perhaps that is why we value it more. — TheVeryIdea

As every object has a temperature, every object is an artwork and has an aesthetic, but not all artworks are of the same quality, as not every object is of the same temperature.

Some artwork appeals to our simplistic nature, such as Bob Ross's Mountain with Lake, and some artwork appeals to our more sophisticated nature, such as Monet's Sunset in Venice.

Simple is different to simplistic, in that Matisse's Cut-Outs are simple, yet sophisticated.

However, the intellect is a product of evolution, meaning that even the most sophisticated aesthetic is still a product of evolution.

why some things make a connection with an audience and some don't — TheVeryIdea

Why does any sight, sound, touch, taste or smell give rise to a subjective emotion. Such as the sight of a sunset, the sound of a bird, the touch of velvet, the taste of wine or the smell of a rose.

The sight of a sunset may arouse in the observer an emotion of delight. Monet's Sunset in Venice may arouse in the observer an emotion of delight. The sunset has meaning to us because it gives us an emotion of delight.

Why would the sunset give us an emotion of delight. Perhaps such experiences are of either general or particular evolutionary benefit.

As described in the Wikipedia article Evolutionary Aesthetics - "Evolutionary aesthetics refers to evolutionary psychology theories in which the basic aesthetic preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. Based on this theory, things like colour preference, preferred mate body ratios, shapes, emotional ties with objects, and many other aspects of the aesthetic experience can be explained with reference to human evolution"

IE, perhaps some things have emotional meaning because they offer either general or particular evolutionary benefit. Perhaps they offer an evolutionary aesthetic.

(Adding in the link)

"Do as I say and not as I do"

http://www.youtube.com/watch?v=5U2UoR-oB1M

"Do as I say and not as I do"

www.youtube.com/watch?v=5U2UoR-oB1M

Comment by Professor Donald Clark:

COP coming to Glasgow. Leaders staying at Gleneagles Hotel & 20 Tesla cars (£100K each) bought to ferry them 75km back & forth. Gleneagles has 1 Tesla charging station, so Malcolm Plant Hire contracted to supply Diesel Generators to recharge Tesla’s overnight. Couldn't make it up.

"reality" — Pop

We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with — Pop

An important element of phenomenology that Husserl borrowed from Brentano is intentionality (often described as "aboutness"), the notion that consciousness is always consciousness of something. It is rooted in Brentano's intentionality, in that reality cannot be grasped directly because it is available through perceptions of reality that are representations of it in the mind. Thoughts, such as beliefs, are directed towards objects, ie, a thought doesn't exist alone.

(n) The problem is how to escape from the circularity. On the one hand, I am conscious of something (an apple) and I interact with it. On the other hand, I interact with something (an apple) and become conscious because of it.

Could Landauer's principle explain it? — Pop

Landauer's principle can be understood to be a simple logical consequence of the second law of thermodynamics. The second law of thermodynamics states that the entropy of isolated systems left to spontaneous evolution cannot decrease. Entropy is defined as a measure of randomness or disorder of a system.

(n) I see no connection between the randomness or disorder of a system and any consciousness resulting from such randomness or disorder.

interaction with them, is probabilistic — Pop

Interaction can be thought of in two ways. At a large scale the classical interaction between two billiard balls, and at a small scale the quantum interactions between elemental particles.

If the game of snooker is considered at the small scale, the theory is that an electron for example can have a non-zero probability of being in more than one distinct state, which is the definition of a superposition state, such that particles don’t have classical properties like “position” or “momentum”, but have a wave function, whose square gives us a probability of position or momentum. Defining "interaction" as that at the small scale, then the current theory does say that behaviour is probabilistic, in that quantum mechanics is non-deterministic because of the Heisenberg Uncertainty Principle

(n) Yes, at a large scale, the system may be static, but at a small scale, the system is dynamic. But I see no connection between a dynamic system and any consciousness resulting from such dynamism.

So an interaction ( resonance )? Sounds like Enactivism to me? — Pop

It does. A quick internet search found an article within the National Library of Medicine by Ryan & Gallagher titled Between Ecological Psychology and Enactivism: Is There Resonance? In their abstract they write "Ecological psychologists and enactivists agree that the best explanation for a large share of cognition is non-representational in kind" and end with "We conclude with future considerations on research regarding the brain as a resonant organ"

(y) Yes, interaction, resonance and enactivism seem important aspects in explaining how the brain functions.

art being a subjective experience of an aesthetic...............This seems very prescriptive — Tom Storm

I think "art being a subjective experience" is uncontroversial. The question is, what kind of subjective experience. There are many possibilities - beauty, emotion, aesthetic, the expression of will, a mimetic, social comment, etc. However, my personal choice is "the aesthetic", but this is more my definition than a rule.

And does this mean that art can be any object which causes a mind to resonate aesthetically? — Tom Storm

Yes, it seems so to me. Art can be a novel by Cormac McCarthy, a song by Sade, the film Shooter, the design of the Golden Gate Bridge, the Pyramids, the 1989 Mercedes-Benz 300SL R107, a prawn, chilli and lemon tagliatelle, Einstein's concept of spacetime, etc.

As every object has a temperature, every object is an artwork and has an aesthetic. But that is when quality comes into the equation.

it is not art that we speak of but our consciousness of art — Pop

(y) Agree, of the three main epistemological approaches, Idealism, Indirect Realism and Direct Realism, I tend to Indirect Realism. In Indirect Realism, the external world exists independently of the mind, and we perceive the external world indirectly, via sense data. Our subjective experience is private, and even if the object remains the same, our subjective experience may change.

it is important to have definitions that we agree on — Pop

(y) Yes. It has been said that "definitions are not all that helpful". Accepting that language with definitions is difficult, language without definitions would be unworkable

If information is understood as evolutionary interaction — Pop

(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information"

deterministic with a slight element of randomness — Pop

(n) A deterministic system cannot be random, unless one brings in free-will

Therefore interaction = information — Pop

(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction.

yes beauty is in the eye of the beholder — Pop

(y) Until the eighteenth century, most philosophical accounts of beauty treated it as an objective quality. Augustine in De Veritate Religione asks explicitly whether things are beautiful because they give delight, or whether they give delight because they are beautiful. He emphatically opts for the second.

Even on the Forum, some still argue that "The observer only uses the act of perception over beauty, but the beauty is still there, regardless of the observer"

Though I'm with Kant, who wrote in The Critique of Judgement -
"The judgment of taste is therefore not a judgment of cognition, and is consequently not logical but aesthetical, by which we understand that whose determining ground can be no other than subjective. Every reference of representations, even that of sensations, may be objective (and then it signifies the real [element] of an empirical representation), save only the reference to the feeling of pleasure and pain, by which nothing in the object is signified, but through which there is a feeling in the subject as it is affected by the representation".

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from. — Pop

The link between what the system experiences and what the system interacts with
David Hume in Moral and Political 1742 wrote "Beauty in things exists merely in the mind which contemplates them.". Is beauty in the thing independent of the observer, or as Hume wrote, in the mind of the observer ?

My strong belief is that there is a direct informative analogy between the observation of an object such as Window at Tangiers by Matisse and a resulting subjective aesthetic experience, and the ability of an opera singer to use their voice alone to shatter a wine glass.

https://www.youtube.com/watch?v=Oc27GxSD_bI

The wine glass shatters. Is it the pitch of the voice that causes the glass to shatter, or is it the shape of the glass that cause the glass to shatter ? It is in fact neither alone, but a resonance between the two, an interaction between the two. In order for the glass to shatter, the voice has to be of one particular pitch and the glass has to be of one particular shape. Resonance is an example of a deterministic cause and effect.

The experience of art requires both a particular artwork and a particular observer, not an artwork alone in the absence of an observer, and not an observer alone in the absence of an artwork. So where is beauty. Beauty cannot exist in an object in the absence of an observer, and beauty cannot exist in an observer in the absence of an artwork. Beauty is a "resonance" between the observer and the artwork.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.

at the moment of interaction the wave function collapses giving rise to consciousness ?................Basically yes — Pop

Koch wrote "By postulating that consciousness is a fundamental feature of the universe, rather than emerging out of simpler elements, integrated information theory is an elaborate version of panpsychism"

Meaning of "integrated"
On observing a system, such as "an apple on the table" my consciousness about "an apple on the table" is integrated. IE, in that a conscious experience is unified and irreducible, in that seeing a blue book is not reducible to seeing a book without the colour blue, plus the colour blue without the book.

Meaning of "information"
Consciousness is specific. Each experience is composed of a specific set of phenomenal distinctions, a blue colour as opposed to no blue colour, no bird as opposed to a bird.

My consciousness is expressed by my "neural state"

a) On observing a system, for example, "an apple on the table", I am conscious of the information contained within the state "an apple on the table".
b) Suppose the system changes
c) On observing the new system, "no apple on the table", I am conscious of the new information contained within the state "no apple on the table".

In @Pop's terms:
1) "information causes a change in neural state"
2) "information is not something static, but something dynamic"
3) "information is the interaction of physical form"

In my terms:
1) The change in information causes a change in neural state.
2) Information is static, a change in information is dynamic.
3) As regards "information", the observer of the system is conscious of information about the system. As regards "interact", the physical form of the observed system interacts with the physical form of the brain's neural state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

The problem of information as fundamental
Taken from John Searle's criticism of Tononi and Koch explanation of Integrated Information Theory

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. Either the information is carried by a conscious experience of some agent (my thought that Obama is president, for example) or in a non-conscious system the information is observer-relative - a conscious agent attributes information to some non-conscious system (as I attribute information to my computer, for example)"

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder"

Art, aesthetics and information
The observer may have information about a piece of art - painted by Andre Derain, dated 1905, titled The Drying Sails, sized 82 × 101 cm.
The observer must be conscious of the artwork in order to know information about it.
The observer has a subjective aesthetic experience when an artwork having a particular physical form interacts with a particular neural brain state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder".

Sentient life is estimated to have evolved on Earth during the Cambrian period about 541 mya to 485 mya. The start of the Universe is estimated at about 13.8 billion years ago. Before sentient life evolved on Earth, physical objects changed with time - lava flowed down the sides of volcanos, rocks bounced down the sides of mountains, etc.

Is it valid to say that the interaction itself is information ?........Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness — Pop

Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ?

I know what you mean, and I don't want to unnecessarily quibble about words, but the choice of word does have an effect.

but what is the source of self organization? — Pop

Yes, where is Force X ?
The problem of strong emergence would be reduced to that of weak emergence if we could discover the missing force acting on the neurons.

If we understand these interactions as information — Pop

In snooker, a cue ball hits a coloured ball at rest. I can describe the system before the interaction by knowing information about the position of interaction, initial cue ball speed and direction. I can describe the system after the interaction by knowing the information about the final cue ball speed and direction, coloured ball speed and direction.

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ?

The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. — Pop

Organising
1) I can organise books on a shelf - the books don't self organise.
2) A computer can organise numbers into increasing size - the numbers don't self-organise.

1) The snooker cue doesn't organise the final resting position of the snooker balls - the final resting position is a consequence of deterministic cause and effect.
2) The wind doesn't organise the final form of the particles of sand - the final form of the sand dune is a consequence of deterministic cause and effect.
3) Force X doesn't organise the final form of the neurons - the final form of consciousness is a consequence of deterministic cause and effect.

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect

Self-organising
At the start of a game of snooker, a snooker cue hits a cue ball which hits a coloured ball, and eventually the snooker balls come to rest.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ?

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X

emergent understanding — Pop

As you mentioned consciousness and emergence, I wonder if the sand dune analogy gives any insights.

If the observer is aware of the particles of sand, force of the wind on them and the resultant form of the sand dunes, they would explain the shape of the sand dunes as an example of "weak emergence". But, if the observer was only aware of the particles of sand and the resultant form of the sand dunes, they would explain the resultant shape of the sand dunes as an example of "strong emergence".

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness.

In practice, we observe a strong emergence of the mind/consciousness from the neurons of the brain. Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism.

It depends on what you understand information to be — Pop

Although slightly digressing, the following is relevant to "The Definition of Art".

As @Mark Nyquist noted, something that may be overlooked is the definition of the word definition.

On the one hand @Banno wrote "definitions are not all that helpful", but on the other hand
writes about InPhO that "the potential is extraordinary". Yet InPhO is founded on the definition. Barry Smith in the video How to Build an Ontology says that the three steps are 1) you create an ontology which in the simplest possible terms is a controlled vocabulary of labels, 2) you provide logical definitions for those labels so that you can compute using the labels and 3) and then you tag the data using those terms typically you tag the data with URI's addresses

Without definitions, communication would be impossible. If I asked someone to pass me the salt, and they did not know the meaning of salt, rather than tell them to read Salt: A World History by Mark Kurlansky, a more useful approach would be to say that salt is a white crystalline substance that gives seawater its characteristic taste and is used for seasoning or preserving food.

It is true as you say that "It depends on what you understand information to be", in that sometimes the same word can mean different things to different people, but without the "principle of charity" communication would become impossible.

Perhaps the reader should treat the writer's words and phrases more like idiomatic expressions than literal descriptions. Often a phrase has a meaning independent of the words used, as "in my job interview I had to jump through hoops", where neither jumping nor hoops were involved.

I fully accept the concept behind Kant's "synthetic a priori", though disagree with the word synthetic being used in combination with the word a priori, in that I have decided to treat synthetic a priori more as an idiomatic expression that a literal description. Similarly with "I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions I fully agree with them, even if I may have a different opinion as to the particular choice of words, ie, information and self organisation.

In short it makes no sense to think of an organism absent of it's environment — Pop

(y) Totally agree.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42)

This approach also seems similar to evolutionary aesthetics and ethics, where the basic aesthetic and ethical preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. A topic initiated by Charles Darwin's The Descent of Man and developed by Herbert Spencer.

Enactivism and the analogy of the sand dune
A particle of sand is subject to forces from other sand particles and the wind, meaning that the dynamic interaction between the sand particles and wind brings about the formation of sand dunes. The sand dune evolves because of an dynamic interaction between the particles of sand and their windy environment. The sand dune cannot be understood absent from its environment. The movement of any particular particle of sand is determined by the forces acting on it from surrounding particles of sand and the wind, a deterministic cause and effect. The particles are organised into sand dunes by the physical nature of each particle and the wind acting on them.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment.

Information about a thing is an extrinsic property of the thing
The evolution of a sand dune is driven by a complex set of wind forces on a complex set of particles of sand. A single mass may be expressed in terms of information, weight, location, etc. A single force can be expressed in terms of information, direction, strength etc, but such information is an extrinsic property of the force rather than an intrinsic property. Therefore, any effect of the force is not determined by any information that can be expressed of the force. Therefore, the evolution of the sand dune is determined by the forces and particles of sand, not by any information that may be expressed of the forces or of the particles of sand.

IE, evolution cannot be driven by information

(y)

An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest. — Tom Storm

Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. — Pop

The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.

IE, how can consciousness interact with itself.