you singled out multiverses in particular as fictional — SophistiCat

Far be it for me to say that the multiverse doesn't exist.

If we can never know whether the multiverse exists or not, even in principle, then we can only know the multiverse as a fictional entity, even if the multiverse does exist as a true fact.

I started this thread to discuss things like the multiverse and my belief that, if I can't know, demonstrate, whether or not it exists, it's existence has no truth value or is meaningless. — T Clark

I know that I have the subjective experience of colours. I believe that you also have the subjective experience of colours.

I can never know that you have, and I can never demonstrate that you have, but for me, the possibility that you have a subjective experience of colours has both a truth value and meaning.

The truth value is that the proposition "T Clark has the subjective experience of colours" is either true or false.

As regards meaning, the fact that you can or can not have the subjective experience of colours has meaning to both you and me.

IE, unprovable beliefs have both a truth value and meaning.

multiverses........You say they are fictional, but we don't know that, because that would be to know that they don't exist. — Janus

My belief, along the lines of Kant's phenomenon and noumenon, is that all understanding we have of complex objects in the world is fictive, whether "unicorns", "tables" or "multiverses".

However, even if our understanding of complex objects in the world is fictive, this is independent of the question as to whether such complex objects as unicorns, tables and multiverses actually exist as facts in the world.

my question is as to whether we can even sensibly speak of the multiverse in terms of being actual or not actual. Intuitively, of course, it seems we can; but if that's right then we do think that untestable conjectures can be true or false. — Janus

How can we talk about "multiverses" when multiverses are unknowable ?

It is the same problem that goes back to Kant's phenomenon and noumenon. Kant proposed that a phenomenon is a perceptive representation of an object existing in the mind of a perceiver, rather than the object in itself, the noumenon. Kant did not argue that the world of the noumenon does not exist, for there to be an appearance, there must be something for there to be an appearance of. It is just that human knowledge of the true nature of the noumenon is impossible, as the true nature of the noumenon is always mediated by the senses. In that, for example, we perceive the colour red, we don't perceive a wavelength of 700nm.

In this sense, all our beliefs are fictional, and every proposition we use is about a fictional object. When we ask, is the proposition "the multiverse exists" true or false, we are not referring to an unknowable entity in the world, but we are referring to a fictional entity "the multiverse". Similarly, when we ask, is the proposition "there is a table in front of me" true or false, whilst it is true that the parts that make up the table exist in the world and are knowable through the senses, the "table" as a whole, as a particular set of parts, only exists in the mind of the observer.

Therefore, complex objects such as "unicorns", "tables", "chairs", "mountains" and " multiverses" only exist in the mind in the imagination, and are therefore fictional. However, the fact that our all our beliefs are about fictional objects makes no pragmatic difference to our ability to exist within the world.

If I want a beer in a Tanzanian bar, all I need to know is to speak the symbol "bia moja tafadhali". I need know no more. I don't need to know the process of what happens between my speaking the symbol and my achieving my goal. The symbol "bia moja tafadhali" has no meaning in itself outside of any context it is used in. My speaking the symbol "bia moja tafadhali" in the context of a Tanzanian bar means that I will be given a beer. The symbol only has meaning within the imagination of the users, and is therefore fictive.

I may believe that "unicorns exist" is a fiction, but I don't know that unicorns don't exist. I may believe that "the multiverse exists" is a fact, but I don't know that multiverses do exist.

Even if unicorns, tables and multiverses must always remain unknowable, "unicorns", "tables" and "multiverses" can be knowable as fictive entities within the observer's imagination.

IE, in answer to your question, we can sensibly speak of the "multiverse", as what we are speaking of is a linguistic fiction, whether or not it is a fact in the world, and as a linguistic fiction can be either true or false.

1) Can a statement be true or false if it is not possible to determine which it is, even in principle? Then, if we can decide that question, 2) What happens if we can't determine if the truth of a statement is decidable in principle or not? — T Clark

If it is not possible to determine even in principle whether the proposition "a multiverse exists" is true/false, then the first problem is not whether the proposition "a multiverse exists" is true or false, but what does "multiverse" mean.

We have the concept multiverse, but if we can never know even in principle whether multiverses exist or not, our concept of multiverse must remain fictional, as a unicorn or Conan Doyle.

IE, if we can never determine even in principle whether the proposition "a multiverse exists" is true or false, then the "multiverse" must remain a fictional entity, as a unicorn or Conan Doyle.

@Janus I can't decide whether the question as to whether propositions that are undecidable for us can nonetheless be true or false is itself undecidable or not"

Starting with @T Clark's question "Can a statement be true or false if it is not possible to determine which it is, even in principle?"
Considering "there is a god beyond our comprehension" as an example of a proposition which we can never know even in principle whether true or false.
So, the answer to @T Clark's question is yes, a proposition such as "there is a god beyond our comprehension" not only can be true or false but must be either true or false.

In answer to @SophistiCat's question as to where does this lead, it leads to the knowledge that there are some things that are beyond our comprehension.

Question 1) Can a statement be true or false if it is not possible to determine which it is, even in principle?
Statement 1) Since there is no evidence whether it is possible to determine the truth or falseness of the multiverse interpretation of QM, should that interpretation be given serious consideration as a scientific theory? — T Clark

There may be no evidence today determining the truth or falseness of the multiverse interpretation of QM, but there may be evidence next year. As @Philosophim wrote: "Maybe humanity will discover the truth about multiverse theory, and maybe they won't"

Question 1) refers to a proposition that it is not possible even in principle to determine whether true or false.

As it may be possible to determine whether the proposition "there is a multiverse" is true or false, it is therefore possible in principle to determine that the proposition "there is a multiverse" is true or false.

Therefore, question 1) has no bearing on statement 1).

(Although I am not sure everyone would agree that there is no evidence for a multiverse)

those things within an art work that draw us in and with which we make an emotional connection. — TheVeryIdea

On seeing Munch's Scream, the screaming face has an immediate emotional meaning.

But the screaming face also has a symbolic meaning, a symbol of of despair, which, when one reflects on it, may result in the remembrance of an emotion of despair.

The question is, when I look at The Scream, am I looking at an analogical representation having immediate emotional meaning or a symbolic representation having a cerebral symbolic meaning which may subsequently result in an emotional meaning.

one might expect everyone to have similar preferences — TheVeryIdea

Wikipedia Novelty Seeking writes - "In psychology, novelty seeking (NS) is a personality trait associated with exploratory activity in response to novel stimulation, impulsive decision making, extravagance in approach to reward cues, quick loss of temper, and avoidance of frustration. Although the exact causes for novelty seeking behaviours is unknown, there may be a link to genetics". This novelty gene is thought to appear in a portion of the human population, something that may explain the differences in our temperaments.

IE, as the worlds of art are fueled by a thirst for novelty, novel creations also carry their own aesthetic merit.

However other more complex symbology, which is often seen as operating at a higher level, is more intellectual and less evolutionary, less base-instinct and perhaps that is why we value it more. — TheVeryIdea

As every object has a temperature, every object is an artwork and has an aesthetic, but not all artworks are of the same quality, as not every object is of the same temperature.

Some artwork appeals to our simplistic nature, such as Bob Ross's Mountain with Lake, and some artwork appeals to our more sophisticated nature, such as Monet's Sunset in Venice.

Simple is different to simplistic, in that Matisse's Cut-Outs are simple, yet sophisticated.

However, the intellect is a product of evolution, meaning that even the most sophisticated aesthetic is still a product of evolution.

why some things make a connection with an audience and some don't — TheVeryIdea

Why does any sight, sound, touch, taste or smell give rise to a subjective emotion. Such as the sight of a sunset, the sound of a bird, the touch of velvet, the taste of wine or the smell of a rose.

The sight of a sunset may arouse in the observer an emotion of delight. Monet's Sunset in Venice may arouse in the observer an emotion of delight. The sunset has meaning to us because it gives us an emotion of delight.

Why would the sunset give us an emotion of delight. Perhaps such experiences are of either general or particular evolutionary benefit.

As described in the Wikipedia article Evolutionary Aesthetics - "Evolutionary aesthetics refers to evolutionary psychology theories in which the basic aesthetic preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. Based on this theory, things like colour preference, preferred mate body ratios, shapes, emotional ties with objects, and many other aspects of the aesthetic experience can be explained with reference to human evolution"

IE, perhaps some things have emotional meaning because they offer either general or particular evolutionary benefit. Perhaps they offer an evolutionary aesthetic.

(Adding in the link)

"Do as I say and not as I do"

http://www.youtube.com/watch?v=5U2UoR-oB1M

"Do as I say and not as I do"

www.youtube.com/watch?v=5U2UoR-oB1M

Comment by Professor Donald Clark:

COP coming to Glasgow. Leaders staying at Gleneagles Hotel & 20 Tesla cars (£100K each) bought to ferry them 75km back & forth. Gleneagles has 1 Tesla charging station, so Malcolm Plant Hire contracted to supply Diesel Generators to recharge Tesla’s overnight. Couldn't make it up.

"reality" — Pop

We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with — Pop

An important element of phenomenology that Husserl borrowed from Brentano is intentionality (often described as "aboutness"), the notion that consciousness is always consciousness of something. It is rooted in Brentano's intentionality, in that reality cannot be grasped directly because it is available through perceptions of reality that are representations of it in the mind. Thoughts, such as beliefs, are directed towards objects, ie, a thought doesn't exist alone.

(n) The problem is how to escape from the circularity. On the one hand, I am conscious of something (an apple) and I interact with it. On the other hand, I interact with something (an apple) and become conscious because of it.

Could Landauer's principle explain it? — Pop

Landauer's principle can be understood to be a simple logical consequence of the second law of thermodynamics. The second law of thermodynamics states that the entropy of isolated systems left to spontaneous evolution cannot decrease. Entropy is defined as a measure of randomness or disorder of a system.

(n) I see no connection between the randomness or disorder of a system and any consciousness resulting from such randomness or disorder.

interaction with them, is probabilistic — Pop

Interaction can be thought of in two ways. At a large scale the classical interaction between two billiard balls, and at a small scale the quantum interactions between elemental particles.

If the game of snooker is considered at the small scale, the theory is that an electron for example can have a non-zero probability of being in more than one distinct state, which is the definition of a superposition state, such that particles don’t have classical properties like “position” or “momentum”, but have a wave function, whose square gives us a probability of position or momentum. Defining "interaction" as that at the small scale, then the current theory does say that behaviour is probabilistic, in that quantum mechanics is non-deterministic because of the Heisenberg Uncertainty Principle

(n) Yes, at a large scale, the system may be static, but at a small scale, the system is dynamic. But I see no connection between a dynamic system and any consciousness resulting from such dynamism.

So an interaction ( resonance )? Sounds like Enactivism to me? — Pop

It does. A quick internet search found an article within the National Library of Medicine by Ryan & Gallagher titled Between Ecological Psychology and Enactivism: Is There Resonance? In their abstract they write "Ecological psychologists and enactivists agree that the best explanation for a large share of cognition is non-representational in kind" and end with "We conclude with future considerations on research regarding the brain as a resonant organ"

(y) Yes, interaction, resonance and enactivism seem important aspects in explaining how the brain functions.

art being a subjective experience of an aesthetic...............This seems very prescriptive — Tom Storm

I think "art being a subjective experience" is uncontroversial. The question is, what kind of subjective experience. There are many possibilities - beauty, emotion, aesthetic, the expression of will, a mimetic, social comment, etc. However, my personal choice is "the aesthetic", but this is more my definition than a rule.

And does this mean that art can be any object which causes a mind to resonate aesthetically? — Tom Storm

Yes, it seems so to me. Art can be a novel by Cormac McCarthy, a song by Sade, the film Shooter, the design of the Golden Gate Bridge, the Pyramids, the 1989 Mercedes-Benz 300SL R107, a prawn, chilli and lemon tagliatelle, Einstein's concept of spacetime, etc.

As every object has a temperature, every object is an artwork and has an aesthetic. But that is when quality comes into the equation.

it is not art that we speak of but our consciousness of art — Pop

(y) Agree, of the three main epistemological approaches, Idealism, Indirect Realism and Direct Realism, I tend to Indirect Realism. In Indirect Realism, the external world exists independently of the mind, and we perceive the external world indirectly, via sense data. Our subjective experience is private, and even if the object remains the same, our subjective experience may change.

it is important to have definitions that we agree on — Pop

(y) Yes. It has been said that "definitions are not all that helpful". Accepting that language with definitions is difficult, language without definitions would be unworkable

If information is understood as evolutionary interaction — Pop

(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information"

deterministic with a slight element of randomness — Pop

(n) A deterministic system cannot be random, unless one brings in free-will

Therefore interaction = information — Pop

(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction.

yes beauty is in the eye of the beholder — Pop

(y) Until the eighteenth century, most philosophical accounts of beauty treated it as an objective quality. Augustine in De Veritate Religione asks explicitly whether things are beautiful because they give delight, or whether they give delight because they are beautiful. He emphatically opts for the second.

Even on the Forum, some still argue that "The observer only uses the act of perception over beauty, but the beauty is still there, regardless of the observer"

Though I'm with Kant, who wrote in The Critique of Judgement -
"The judgment of taste is therefore not a judgment of cognition, and is consequently not logical but aesthetical, by which we understand that whose determining ground can be no other than subjective. Every reference of representations, even that of sensations, may be objective (and then it signifies the real [element] of an empirical representation), save only the reference to the feeling of pleasure and pain, by which nothing in the object is signified, but through which there is a feeling in the subject as it is affected by the representation".

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from. — Pop

The link between what the system experiences and what the system interacts with
David Hume in Moral and Political 1742 wrote "Beauty in things exists merely in the mind which contemplates them.". Is beauty in the thing independent of the observer, or as Hume wrote, in the mind of the observer ?

My strong belief is that there is a direct informative analogy between the observation of an object such as Window at Tangiers by Matisse and a resulting subjective aesthetic experience, and the ability of an opera singer to use their voice alone to shatter a wine glass.

https://www.youtube.com/watch?v=Oc27GxSD_bI

The wine glass shatters. Is it the pitch of the voice that causes the glass to shatter, or is it the shape of the glass that cause the glass to shatter ? It is in fact neither alone, but a resonance between the two, an interaction between the two. In order for the glass to shatter, the voice has to be of one particular pitch and the glass has to be of one particular shape. Resonance is an example of a deterministic cause and effect.

The experience of art requires both a particular artwork and a particular observer, not an artwork alone in the absence of an observer, and not an observer alone in the absence of an artwork. So where is beauty. Beauty cannot exist in an object in the absence of an observer, and beauty cannot exist in an observer in the absence of an artwork. Beauty is a "resonance" between the observer and the artwork.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.

at the moment of interaction the wave function collapses giving rise to consciousness ?................Basically yes — Pop

Koch wrote "By postulating that consciousness is a fundamental feature of the universe, rather than emerging out of simpler elements, integrated information theory is an elaborate version of panpsychism"

Meaning of "integrated"
On observing a system, such as "an apple on the table" my consciousness about "an apple on the table" is integrated. IE, in that a conscious experience is unified and irreducible, in that seeing a blue book is not reducible to seeing a book without the colour blue, plus the colour blue without the book.

Meaning of "information"
Consciousness is specific. Each experience is composed of a specific set of phenomenal distinctions, a blue colour as opposed to no blue colour, no bird as opposed to a bird.

My consciousness is expressed by my "neural state"

a) On observing a system, for example, "an apple on the table", I am conscious of the information contained within the state "an apple on the table".
b) Suppose the system changes
c) On observing the new system, "no apple on the table", I am conscious of the new information contained within the state "no apple on the table".

In @Pop's terms:
1) "information causes a change in neural state"
2) "information is not something static, but something dynamic"
3) "information is the interaction of physical form"

In my terms:
1) The change in information causes a change in neural state.
2) Information is static, a change in information is dynamic.
3) As regards "information", the observer of the system is conscious of information about the system. As regards "interact", the physical form of the observed system interacts with the physical form of the brain's neural state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

The problem of information as fundamental
Taken from John Searle's criticism of Tononi and Koch explanation of Integrated Information Theory

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. Either the information is carried by a conscious experience of some agent (my thought that Obama is president, for example) or in a non-conscious system the information is observer-relative - a conscious agent attributes information to some non-conscious system (as I attribute information to my computer, for example)"

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder"

Art, aesthetics and information
The observer may have information about a piece of art - painted by Andre Derain, dated 1905, titled The Drying Sails, sized 82 × 101 cm.
The observer must be conscious of the artwork in order to know information about it.
The observer has a subjective aesthetic experience when an artwork having a particular physical form interacts with a particular neural brain state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder".

Sentient life is estimated to have evolved on Earth during the Cambrian period about 541 mya to 485 mya. The start of the Universe is estimated at about 13.8 billion years ago. Before sentient life evolved on Earth, physical objects changed with time - lava flowed down the sides of volcanos, rocks bounced down the sides of mountains, etc.

Is it valid to say that the interaction itself is information ?........Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness — Pop

Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ?

I know what you mean, and I don't want to unnecessarily quibble about words, but the choice of word does have an effect.

but what is the source of self organization? — Pop

Yes, where is Force X ?
The problem of strong emergence would be reduced to that of weak emergence if we could discover the missing force acting on the neurons.

If we understand these interactions as information — Pop

In snooker, a cue ball hits a coloured ball at rest. I can describe the system before the interaction by knowing information about the position of interaction, initial cue ball speed and direction. I can describe the system after the interaction by knowing the information about the final cue ball speed and direction, coloured ball speed and direction.

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ?

The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. — Pop

Organising
1) I can organise books on a shelf - the books don't self organise.
2) A computer can organise numbers into increasing size - the numbers don't self-organise.

1) The snooker cue doesn't organise the final resting position of the snooker balls - the final resting position is a consequence of deterministic cause and effect.
2) The wind doesn't organise the final form of the particles of sand - the final form of the sand dune is a consequence of deterministic cause and effect.
3) Force X doesn't organise the final form of the neurons - the final form of consciousness is a consequence of deterministic cause and effect.

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect

Self-organising
At the start of a game of snooker, a snooker cue hits a cue ball which hits a coloured ball, and eventually the snooker balls come to rest.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ?

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X

emergent understanding — Pop

As you mentioned consciousness and emergence, I wonder if the sand dune analogy gives any insights.

If the observer is aware of the particles of sand, force of the wind on them and the resultant form of the sand dunes, they would explain the shape of the sand dunes as an example of "weak emergence". But, if the observer was only aware of the particles of sand and the resultant form of the sand dunes, they would explain the resultant shape of the sand dunes as an example of "strong emergence".

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness.

In practice, we observe a strong emergence of the mind/consciousness from the neurons of the brain. Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism.

It depends on what you understand information to be — Pop

Although slightly digressing, the following is relevant to "The Definition of Art".

As @Mark Nyquist noted, something that may be overlooked is the definition of the word definition.

On the one hand @Banno wrote "definitions are not all that helpful", but on the other hand
writes about InPhO that "the potential is extraordinary". Yet InPhO is founded on the definition. Barry Smith in the video How to Build an Ontology says that the three steps are 1) you create an ontology which in the simplest possible terms is a controlled vocabulary of labels, 2) you provide logical definitions for those labels so that you can compute using the labels and 3) and then you tag the data using those terms typically you tag the data with URI's addresses

Without definitions, communication would be impossible. If I asked someone to pass me the salt, and they did not know the meaning of salt, rather than tell them to read Salt: A World History by Mark Kurlansky, a more useful approach would be to say that salt is a white crystalline substance that gives seawater its characteristic taste and is used for seasoning or preserving food.

It is true as you say that "It depends on what you understand information to be", in that sometimes the same word can mean different things to different people, but without the "principle of charity" communication would become impossible.

Perhaps the reader should treat the writer's words and phrases more like idiomatic expressions than literal descriptions. Often a phrase has a meaning independent of the words used, as "in my job interview I had to jump through hoops", where neither jumping nor hoops were involved.

I fully accept the concept behind Kant's "synthetic a priori", though disagree with the word synthetic being used in combination with the word a priori, in that I have decided to treat synthetic a priori more as an idiomatic expression that a literal description. Similarly with "I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions I fully agree with them, even if I may have a different opinion as to the particular choice of words, ie, information and self organisation.

In short it makes no sense to think of an organism absent of it's environment — Pop

(y) Totally agree.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42)

This approach also seems similar to evolutionary aesthetics and ethics, where the basic aesthetic and ethical preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. A topic initiated by Charles Darwin's The Descent of Man and developed by Herbert Spencer.

Enactivism and the analogy of the sand dune
A particle of sand is subject to forces from other sand particles and the wind, meaning that the dynamic interaction between the sand particles and wind brings about the formation of sand dunes. The sand dune evolves because of an dynamic interaction between the particles of sand and their windy environment. The sand dune cannot be understood absent from its environment. The movement of any particular particle of sand is determined by the forces acting on it from surrounding particles of sand and the wind, a deterministic cause and effect. The particles are organised into sand dunes by the physical nature of each particle and the wind acting on them.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment.

Information about a thing is an extrinsic property of the thing
The evolution of a sand dune is driven by a complex set of wind forces on a complex set of particles of sand. A single mass may be expressed in terms of information, weight, location, etc. A single force can be expressed in terms of information, direction, strength etc, but such information is an extrinsic property of the force rather than an intrinsic property. Therefore, any effect of the force is not determined by any information that can be expressed of the force. Therefore, the evolution of the sand dune is determined by the forces and particles of sand, not by any information that may be expressed of the forces or of the particles of sand.

IE, evolution cannot be driven by information

(y)

An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest. — Tom Storm

Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. — Pop

The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.

IE, how can consciousness interact with itself.

Lots of questions.

Are you someone who thinks art has a responsibility? — Tom Storm

No. Neither Derain nor Derain's La Rivière bear any responsibility, no more than an apple sitting on a table bears any responsibility. Though the Derain provides an opportunity.

What the Derain does give is a glimpse that there is something deeper and more profound than what is seen on the superficial surface of shapes and colours, of a figure walking past a house next to a river. The painting achieves this using an aesthetic form of pictographic content. What is hidden is not explained, but what is explained is that there is something hidden.

The aesthetic of art is what separates an airport novel from a Hemingway. Superficially,The Old Man and the Sea is a simple story of Santiago, an ageing experienced fisherman, but concealed beneath the words is a complex allegorical commentary on all his previous works.

We are muggles innocently walking along Diagon Alley, unaware of a hidden and mysterious and magical world just out of our reach, hidden by many powerful spells of concealment, seemingly lacking a key. But with art we do have the key. The key is our innate a priori ability to experience aesthetic form, an ability to discover pattern in seeming chaos, enabling the search and discovery of new understanding and knowledge.

Does your perspective risk a subjectivist aesthetic? — Tom Storm

I have the subjective experiences of seeing the colour red, hearing a grating noise, tasting something bitter, smelling something acrid, perceiving aesthetic form. These are not risks to my perspective, these are what I am.

Modernist (capital M) work like Braque's Cubism has an aesthetic too, but is it beautiful? Cannot something which is 'ugly" (however you define this) not also provide a profound aesthetic experience? — Tom Storm

Exactly. Aesthetic is used as an adjective and as a noun.

Aesthetic as an adjective is the study of beauty.

But beauty as a noun surely has a different meaning to aesthetic as a noun. For example, taking the examples of Picasso's Guernica 1937, a moving and powerful anti-war painting, and Bouguereau's 1873 Nymphs and Satyr, mythological themes emphasising the female human body

Dictionary definitions generally agree that aesthetic as a noun means a set of principles governing the idea of beauty, such as "modernist aesthetics" and beauty as a noun means qualities such as shape, colour, sound in a person or thing that gives pleasure to the senses.

Both the Picasso and Bouguereau are important paintings and have aesthetic values. Whilst the Bouguereau may be said to give pleasure to the senses, the Picasso certainly doesn't.

IE, it follows that the aesthetic must be more than being concerned with beauty.

how does one go about identifying what counts as the aesthetic and what does not? — Tom Storm

There are numerous definitions of the aesthetic, from non-utilitarian pleasure to truth. Articles about aesthetics generally conflate aesthetic with beauty. As an aesthetic object can be ugly, the aesthetic and beauty are two different concepts. Therefore, looking at the Wikipedia article on aesthetics, for example, and removing any conflation between aesthetic and with beauty one is left with the following text:

It examines aesthetic values often expressed through judgments of taste
The word aesthetic is derived from the Greek, pertaining to sense perception.
In practice, aesthetic judgement refers to the sensory contemplation or appreciation of an object (not necessarily a work of art)
Judgments of aesthetic value rely on the ability to discriminate at a sensory level.
Aesthetic judgments may be linked to emotions or, like emotions, partially embodied in physical reactions
.It is said, for example, that "beauty is in the eye of the beholder".
It may be possible to reconcile these intuitions by affirming that it depends both on the objective features of the beautiful thing and the subjective response of the observer.
Classical conceptions emphasize the objective side of beauty by defining it in terms of the relation between the beautiful object as a whole and its parts: the parts should stand in the right proportion to each other and thus compose an integrated harmonious whole.
Aesthetic considerations such as symmetry and simplicity are used in areas of philosophy, such as ethics and theoretical physics and cosmology to define truth, outside of empirical considerations

Summarising the above - when observing a particular object in the world using the senses of sight, hearing, etc, and experiencing a particular subjective emotion or feeling brought on by a judgement that the parts of the object are combined in the right proportion to make a harmonious whole, then this is the aesthetic. In my terms, the aesthetic is a discovered unity within an observed variety.

Is all post-modern art free of aesthetic merit ? — Tom Storm

Postmodernism included art, beauty and aesthetics in their attack on contemporary society and culture. As yet, there is no unified postmodern aesthetic, but remain disparate agendas, as discussed in Hal Foster's The Anti-Aesthetic: Essays on Postmodern Culture.

As every object has a temperature, but not to the same degree, every object is an artwork, has beauty and has an aesthetic, but also not to the same degree. Even though Monet's Waterlily and a train timetable have an aesthetic, a Monet Waterlily has a greater aesthetic merit than a train timetable.

As the postmodernists have no agreed definition of the aesthetic, it is difficult to say whether or not postmodernism has an aesthetic of merit.

As regards my understanding of the modernist concept of the aesthetic - a discovered unity within an observed variety - postmodernism is free of modernist aesthetic merit, mainly because it has been a deliberate act on the part of the postmodernists to remove any modernist aesthetic.

Can you clarify how you would apply your modernist perspective to pre-modern era work? Say a Titian. — Tom Storm

Sentient life is thought to have started during the Cambrian Period, 541 mya to 485 mya and modern humans evolved from archaic humans 200,000 to 150,000 years ago.

It seems clear to me that the pre-1950 examples of art have features in common, and these features are different to the post 1950's examples. In fact, the pre 1950's examples could have been created by the same artist. As regards representation, pre 1950's is pictographic and post 1950's is symbolic. As regards aesthetic form, pre 1950's exhibit a distinct aesthetic quality whilst post 1950's minimise aesthetic quality.

The modernist style of the Modernist movement goes back to at least to the Lascaux cave paintings, painted by modern humans about 20,000 years ago. IE, the modernist style is not new, but is a feature of modern human art.

Frege.......Santa Claus and psychologism, — Shawn

Adding background for my own benefit.

Psychologism and anti-psychologism
Frege, founder of logicism, attacked psychologism in his book The Foundations of Arithmetic

Psychologism is where psychology plays a central role in explaining some non-psychological fact in the world and where the observer interprets events in the world in subjective terms. Anti-psychologism, aka logical realism, is the position that the nature of logical truth does not depend on the contents of human ideas but exists independently of human ideas

It seems that psychologism is similar to David Dummett's Anti-Realism, where external reality is hypothetical and is not assumed and the truth of a statement rests on internal logic. Anti-psychologism seems similar to Realism, the truth of a statement rests on its correspondence to an external independent reality independent of beliefs.

It also seems that Frege's anti-psychologism requires that relations have an ontological existence in the world, in that tables, apples, mountains exist independently of any observer.

Internal and external relations
There is a distinction between internal relations and external relations. Internal relations are necessary in that the properties of a thing are essential to the existence of the thing. For example, a table composed of parts, a table top and legs. If the parts were removed then the table would cease to exist. External relations are contingent, in that whether a table is in a garden or in a living room does not affect the existence of the table.

However, FH Bradley argued against external relations using a regress argument, such that either a relation R is nothing to the things a and b it relates, in which case it cannot relate them, or, it is something to them, in which case R must be related to them. In other words, a table top may be above table legs, but where exactly does the relation "above" exist. There is no information in the table top that it is above table legs, there is no information in the table legs that they are below the table top and there is no information in the space between them that there is a table top at one end and table legs at the other.

I see no metaphysical difference between internal relations and external relations. There may be an internal relation between a table and the table top, but at the same time, there is also the external relation between the table top and the table. Wittgenstein discusses something similar in para 59 of Philosophical Investigations - "A name signifies only what is an element of reality. What cannot be destroyed; what remains the same in all changes."—But what is that?....................We see component parts of something composite (of a chair, for instance). We say that the back is part of the chair, but is in turn itself composed of several bits of wood; while a leg is a simple component part. We also see a whole which changes (is destroyed) while its component parts remain unchanged. These are the materials from which we construct that picture of reality"

Frege and Santa Claus
Frege's attack on psychologism seems to me to suggest that Frege supported the idea that relations have an ontological existence in the world. But for me the problem remains, as pointed out by Bradley, exactly where in the world are these relations ? I can appreciate that the parts table top and table legs exist in the world and are spatially separate, but I cannot accept that "above" has an independent existence in the world.

IE, if Frege supported anti-psychologism, it follows that he must have supported the idea that relations have an ontological existence in the world. Therefore, not only must he have believed that the parts of Santa Claus have a real existence in the world, plump, white-bearded, red-suited, etc, but also that the relations between these parts have a real existence in the world, meaning that a Santa Claus consisting of real relationship between real parts must have a real existence in the world.

Are you going by an account of aesthetics rooted in modernist theory, or are you just using the terms as you see them apply? — Tom Storm

I am distinguishing between modernism and Modernism, whilst defining modernism as art that includes aesthetic quality.

Some reference material includes aesthetics as part of the definition of Modern Art and some don't. Generally they don't. For example, the Tate UK description of Modernism doesn't mention the aesthetic. The V&A article on "What was Modernism" mentions beauty. The Wikipedia article on Modernism has a small reference to aesthetics.

And yet there is The British Journal of Aesthetics which promotes debate in philosophical aesthetics and the philosophy of art.

However, it seems to me that the aesthetic is the primary dividing line within art as discussed today.

Even though not central to contemporary articles on Modern Art, I would argue that every important artwork pre-1960 had aesthetic quality, from the Lascaux cave paintings, through Egyptian, Greek and Roman art, from medieval religious art to Impressionism.

Whereas, I would also argue that no important Postmodern art since the 1960's has had aesthetic quality, partly due to Postmodernism's deliberate exclusion of any aesthetic.

IE, within modernism are many different approaches, as with postmodernism, but for me the primary dividing line within art is the presence or absence of the aesthetic.

The process of determining their commitment as ontological entities seems important to say as clear as possible, that they are a fiction. — Shawn

The fictional "Santa Claus" has an ontological existence,
The name "Santa Claus" exists within fiction, fiction exists within language, language exists within the physical structure of the brain, the brain exists as part of the world and is not separate to it, meaning that "Santa Claus" does have an ontological existence in the world.

Where "Santa Clause" exists depends on the ontological nature of relations
The question as to whether relations between parts has an ontological existence in the world is not agreed.

Wittgenstein in para 60 of Philosophical Investigations discusses composite objects composed of parts in relation to each other.

The mind is only able to contemplate a fictional character - Santa Claus, unicorns, Bart Simpson, etc - if the mind already has priori knowledge of the real parts that make up the mereological whole. For example, Santa Claus may be a fictional character, but its parts are known a priori as having ontological existences in the world - plump, white-bearded, red-suited, jolly, old, man, Christmas presents, children. IE, the mind cannot invent parts for which it does not already have a priori knowledge.

Either relations don't have an ontological existence in the world or they do.

If they don't, then relations exist only in the mind and not the world. Such that tables, being a relation between a table top and table legs, don't exist in the world but only in the mind. Similarly, Santa Claus, being a relation between plump, white-bearded, etc doesn't exist in the world but only in the mind.

If they do, then not only tables but Santa Claus exists in the world as mereological objects

Admittedly the parts of Santa Claus are physically separated, but then so are the table top and the table legs, which combine to form a table, and so are the broomstick and the brush in Wittgenstein's example, which combine to form a brush. The parts combine into a "simple" whole. And the "simple" whole ontologically exists in the world.

It could be argued that one problem with mereological objects that every possible combination of parts becomes an object, such that my pen and the Eiffel Tower becomes a "peffel". However, it is in the nature of the mind to name only those mereological objects that it finds pragmatically useful, discarding the uselessness of the concept "peffel" for the usefulness of the concept "table". Therefore, human vocabulary is a mirror of those concepts that the human pragmatically requires in order to evolve within the world.

IE, if relations don't have an ontological existence in the world, Santa Claus only exists in the mind. But if relations do have an ontological existence in the world, then Santa Claus exists in the world.

The information is not so much in the brick, but in the fact that a person who has total freedom to do as they like, chooses to put a brick on a pedestal. — Pop

Perhaps this remains the sticking point, in that I tend to Modernism whilst you may be leaning towards Postmodernism. Both valid as definitions of art, but different.

Within Postmodernism, an artist has total freedom to create whatever object, concept, performance they want for it to be called art.

Whereas in Modernism, regardless of the definition of art, some objects have artistic value and some don't, where someone who makes an object with artistic value is an artist and someone who makes an object lacking artistic value isn't an artist.

IE, personally, I don't agree with the Postmodernist definition of art, because the words art and artist lose all meaning, as everything can be art and everyone can be an artist.

why is this such a prominent feature of language to posit an ontology for Pegasus or Santa Claus? — Shawn

Perhaps this is what Wittgenstein was talking about in para 58 of Philosophical Investigations, where I think he is saying that a name such as "Santa Claus" is part of the language game, not an ontological part of the world.

You are highlighting that the observer interprets the artwork entirely in terms of their own consciousness — Pop

(y) Yes, "art work is information about............consciousness".

But the only consciousness I have ever known is my own. I assume there are other consciousnesses out there in the world, but I may be wrong, I will never know. Even if there are consciousnesses out there other than my own, I will never have any consciousness of a consciousness that is not my own.

IE, as art is information about consciousness, and the only consciousness that I know exists is my own, art can only be information about my own consciousness.

information has a chronological progression. It is causal, — Pop

(y) Yes, information flow is chronological.

As regards Postmodernism, there is no information within a brick that gives the viewer information about the state of mind of Carl Andre. As regards Modernism, there is no information within a painting of a sombre scene whether the artist was in a sombre or happy mood when they painted it.

So art expresses the same "self organization" that ordered form in the universe expresses — Pop

The figurine is an object that can be described as art, was made by a consciousness, where consciousness is a result of some kind of self-organisation, can be described as information and expresses something to the observer.

When someone observes information, the information can only express something to the observer if the observer can make sense of the information, can see patterns in the information, in that the information is not chaotic. IE, information by itself cannot express anything to the observer until the observer is able to see patterns in the information.

The patterns the observer is able to see is a function of the observer's mind, the observer's consciousness, and is not a function of whatever caused the figurine to come into existence.

IE, seeing art in the figurine is an expression of the observer's consciousness rather than any history prior to the creation of the figurine.

(y) This doesn't affect the idea that art is information about the conscious self-organising mind, it just moves the mind from the maker of the object to the observer of the object.

what can be inferred about the mind activity that made the work, from the work alone — Pop

(y) Anything about art is interesting.

(y) As regards, Integrated Information Theory, I tend to panprotopsychism as an explanation rather than panpsychism.

There is a flow of information - but in what direction ?

I agree that art, especially the aesthetic in art, is a fundamental expression of human consciousness, and art is information, but the question is, in what direction is this information flowing ?

The answer is different for Modernism and Postmodernism

In Modernism, which uses aesthetic form of pictographic representation, as soon as the artist has completed the artwork, the artwork takes on a meaning independent of the artist.

In Postmodernism, which uses symbolic representation, the meaning of the artwork remains tied the artist.

There is a difference between the "maker artist" and the "observer artist"

You write (quote 1) "to explore what can be inferred about the mind activity that made the work" and (quote 2) "you would have to ask the person deeming one object art, and the other one not.....................in an ideal setting we should be able to infer a lot of their mind activity from the clues provided in what they choose as their art".

Quote 1) is about the maker of the artwork as artist. Quote 2) is about the observer of the artwork as artist. Generally writings about art don't make the critical distinction between the person who made the artwork and the person who recognises an object is an artwork. My position is that there is no fundamental, philosophical, metaphysical difference between the "observer artist" and the "maker artist". The person who sees an object and recognises it as an artwork is as much an "artist" as the person who made the artwork. The only differences are practical, in that the "maker artist" has certain skills that the "observer artist" doesn't.

This skill that has taken many years to learn separates the "maker artist" from the "observer artist". The person who appreciates the artistic quality of a Van Gogh has the same artistic appreciation as Van Gogh himself, the difference being that Van Gogh had a profound skill and technical ability in the making of an artwork, whether conscious or instinctual, that most people can never approach.

IE, the difference between an admirer of a Van Gogh and Van Gogh himself is not of artistic sensibilities but of technical skill.

Postmodernism

In Postmodernism, information must flow from the artist that made the artwork to the observer of the artwork, and such information must flow separate to the artwork.

For example, Carl Andre's Bricks, where the meaning of the brick as a symbol cannot be discovered in the symbol itself, but only in the mind of the maker of the artwork.

Modernism

You write "to explore what can be inferred about the mind activity that made the work". I would argue that it is impossible to discover from a Modernist artwork anything about the mind of the maker of the artwork for the following reasons:

1) Some artworks have two or more makers, such as the collaborative work of Ruth Lozner and Kenzie Raulin. To which mind does the artwork have insight into ?
2) Some artworks are ambiguous, such as Monet's St Lazare Station. Is Monet referring to progress in the 20th C or the interplay of light onto physical objects ?
3) Some artworks have no artist makers, only observer artists, for example Warhol's Brillo Box
4) The same artist may paint in completely different styles, such as Van Gogh's early and late period.
5) Different artists may have painted in the same style, such as the Fauves. Vlaminck having a reputation as a loudmouth, troublemaker, and womanizer, whilst Matisse had a conservative appearance and strict bourgeois work habits.
6) The same artist, such as Briton Riviere, may paint a scene of despair Fidelity or of joyful humour Geese
7) Picasso painted Guernica at his home in Paris away from the bombings in Spain, whilst Monet painted Water lilies to the sounds of war.
8) An atheist may paint a religious scene, as Francis Bacon's Crucifixion and the Pope, whilst a religious person may paint a secular scene, such as Caravaggio
9) Interpretation of an artwork is open to debate. Robert Frost's The Road Not Taken is popularly generally taken as a poem about hope, success, and defying the odds, whereas it is in fact the opposite.
10) A contemporary performance of a Mozart piano sonata uses a different type of piano to that used by Mozart, meaning that the modern concert goer is hearing a different sound to that intended by the composer, meaning that a modern performance cannot be expressing what was in the composer's mind.

IE, there is a practical impossibility for the observer to discover links from the artwork into the mind of the artist.

Summary - information cannot flow from the maker of the artwork to the observer via the artwork.

The direction of flow of information is a crucial consideration in art.

In Modernism, which uses aesthetic form of pictographic representation, as soon as the artist has completed the artwork, the artwork takes on a meaning independent of the artist. Information flows between the maker of the artwork and the artwork, between the artwork and the observer of the artwork, but cannot flow from the maker of the artwork to the observer via the artwork.

In Postmodernism, which uses symbolic representation, the meaning of the artwork remains tied to the artist. Information flows between the maker of the artwork and the artwork, and from the maker of the artwork to the observer of the artwork by-passing the artwork entirely, but cannot flow from the maker of the artwork to the observer via the artwork.

Before it is art, it has to be deemed to be art. — Pop

Suppose a person is conscious of the information arriving through their senses from two objects in the world.

For what reasons would that person deem one object to be art and the other object not art ?

We now know definitively that all art is information - since information is fundamental. The only question that then remains for art is - information about what? And the obvious answer is consciousness. — Pop

(y) I can see that Integrated Information Theory and Peirce's Theory of Pragmatic Information would be relevant to the meaning of art, and should therefore be considered.

I walk along a path and see a few blown pieces of coloured paper on the ground, making a shape that appeals to me. I pick them up, put them in a frame and hang it on my wall. One year later, happening to visit MoMA, I notice exactly the same image as on my wall, but titled Matisse CutOut. As the two artworks are identical, the artistic quality of the artwork must be independent of whatever created it. I don't care whether the artwork was created by a 20 year old or a 80 year old, was French or Peruvian, had a headache or was worried about paying the rent, in that whatever created the artwork is irrelevant in the recognition of the object as an artwork.

It is true that i) to be conscious is to be conscious of something, ie, intentionality ii) consciousness creatively organises information iii) the observer of the artwork is conscious of receiving information from the artwork, shapes, colours, relationships, etc.

@Pop - i) "art work is information about the artist's consciousness" ii) "art conveys.........the consciousness of the artist" iii) "art's function is to express our consciousness". Summarising, the artwork expresses the consciousness of the artist.

But an actuary table is not art, and a Matisse CutOut is art. Therefore there must be a conscious act of determining what is art and what isn't. If whatever created the object is irrelevant in the recognition of the object as an artwork, and the object itself cannot determine that is an artwork, then the conscious act of determining the object as an artwork must be in the observer.

But the observer only knows that the object is an artwork by recognizing it as an artwork, regardless of the intentions of whatever made the object.

IE, looking at the object as an artwork is an expression of the ability of the observer to recognize an object as an artwork, rather than any expression of the observer's ability to look into the mind of whatever made it.

They have an information theoretic running through them, which I am in the process of understanding. — Pop

For my own knowledge:

Is Norbert Wiener's 1950 The Human Use of Human Beings: Cybernetics and Society relevant to your position - where art is just a part of patterns of information within the world ?

Also, is the article Dissecting landscape art history with information theory 2020 in the Proceedings of the National Academy of Sciences of the United States of America relevant to your position - whose approach at a meta-narrative is that of a quantitative understanding of a landscape painting rather than a qualitative one ?

I think art is to grounded in the aesthetic, and the aesthetic is to be grounded in affect. — Constance

@Constance "Calling an eclair sweet is certainly not a priori"

(y) True. As further described by post-Darwinian "evolutionary aesthetics" and "evolutionary ethics", humans are born with certain innate abilities, in that the brain is not a blank slate. The contemporary word "innate" serves the same purpose as Kant's 18th C word "a priori".

There is a certain ambiguity in the phrase "a priori knowledge". On the one hand it can mean a priori knowledge of the subjective experience of the colour red, sweet taste, aesthetic form, etc. On the other hand it can mean that some people have a genetic predisposition to certain skills and abilities, whether being naturally good at languages, mathematics, people skills, dance, football, etc, where such innate knowledge is not of the goal itself - but an instinctive understanding of how to achieve the goal

IE, it is a priori knowledge of how to achieve a goal rather than a priori knowledge of the goal itself.

@Constance "visual form may elicit the aesthetic...........form itself is not aesthetic"
@Constance "Affect is..............the essential feature of art"
@Constance "I think art is to grounded in the aesthetic, and the aesthetic is to be grounded in affect"

(y) I agree. Clive Bell proposed the concept of "Significant Form", where "There must be some one quality without which a work of art cannot exist; possessing which, in the least degree, no work is altogether worthless" and "lines and colours combined in a particular way, certain forms and relations of forms, stir our aesthetic emotions".

Commentators write "the origin of the aesthetic emotion is within the object itself", but such explanations are ambiguous. Someone observes an object, and there is something about the particular form of the object that induces an aesthetic experience in the mind of the observer. The thing to note is that the object only has a form that is significant to the observer, not that the object has a significant form that is independent of any observer

IE, "significant Form" exists in the observer, not the object observed.

@Constance "This brings the issue to Wittgenstein and why he refused to talk about ethics and aesthetics"

(y) Wittgenstein wrote in TLP 6.421 "It is clear that ethics cannot be put into words. Ethics is transcendental".

In a sense Wittgenstein refused to talk and ethics and aesthetics, but as Bertrand Russell wrote in the introduction to the Tractatus "Mr. Wittgenstein manages to say a good deal about what cannot be said, thus suggesting to the sceptical reader that possibly there may be some loophole through a hierarchy of languages, or by some other exit".

In a letter to Bertrand Russell, Wittgenstein complained that the British philosopher did not understand the main message of theTractatus. He explained that “the main point is the theory of what can be expressed by propositions—i.e., by language . . . and what cannot be expressed by propositions, but only shown; which, I believe, is the cardinal problem of philosophy”

But in practice, philosophers have made reasonable livings from teaching and writing books about aesthetics and ethics, so it cannot be as clear cut as Wittgenstein suggests.

It is interesting fact that I know for certain that my private subjective experience of the sweet taste of an eclair and aesthetic form are the same as yours, as much as I know that there is a cup of tea on the table in front of me.

So how is it that communication using language is possible, using public words such as sweetness of taste and aesthetic form, where such public words refer to private subjective experiences that can never be described in words.

So how do I know for certain that my private subjective experience of aesthetic form is the same as your private subjective experience of aesthetic form, when the only thing they have in common is the public word "aesthetic form".



Using only six pictures, I believe the meaning of "togavata" would be generally understood, sufficient to be able to classify the final picture on the far right as either "togavayat" or not "togavata"

IE, I cannot describe my private subjective experience of "togavata", yet I can relatively easily communicate my private subjective experience of "togavata" by attaching a public word to it.

Language is thereby able to communicate private subjective experiences by linking public words to them, thereby allowing language to be used to communicate private subjective experiences, whether aesthetic form, sweetness of taste, the pain of a headache, etc.

IE, Wittgenstein could have sensibly talked about aesthetics and ethics by linking public words to his private experiences of them.

Can you identify a critic or writer who embodies this view — Tom Storm

In particular - Professor Denis Dutton.

In general - "Evolutionary Aesthetics".

Professor Dutton talks about "The Art Instinct" at www.youtube.com/watch?v=R-Di86RqDL4

(a priori knowledge).. .....This post is not relevant to the discussion — T Clark

Since at least the Lascaux cave paintings 17,000 years ago, beauty and aesthetics have been considered part of the essence of the meaning of art, part of the "definition of art".

Sentient life is born with certain innate "a priori" abilities. We are able to know the subjective experience of the colour red, a bitter taste, an acrid smell, the pain of a headache, as well as aesthetic form. These subjective experiences don't need to be taught in school.

In Western philosophy since the time of Immanuel Kant, such knowledge, acquired independently of any particular experience, has been known as "a priori knowledge".

IE, any discussion of art needs an understanding of aesthetics, which in its turn needs an understanding of "a priori knowledge".